Incidental Mutation 'R6129:Gm5431'
ID487581
Institutional Source Beutler Lab
Gene Symbol Gm5431
Ensembl Gene ENSMUSG00000058163
Gene Namepredicted gene 5431
Synonyms
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location48887422-48902214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48889591 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 168 (L168P)
Ref Sequence ENSEMBL: ENSMUSP00000104833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109209] [ENSMUST00000109210] [ENSMUST00000109212]
Predicted Effect probably damaging
Transcript: ENSMUST00000109209
AA Change: L168P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104832
Gene: ENSMUSG00000058163
AA Change: L168P

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109210
AA Change: L168P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104833
Gene: ENSMUSG00000058163
AA Change: L168P

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109212
AA Change: L446P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104835
Gene: ENSMUSG00000058163
AA Change: L446P

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2.5e-125 PFAM
Pfam:DLIC 54 107 3.4e-5 PFAM
Pfam:MMR_HSR1 72 235 1.7e-11 PFAM
low complexity region 431 444 N/A INTRINSIC
Pfam:IIGP 447 820 6.3e-153 PFAM
Pfam:MMR_HSR1 483 606 2.4e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Gm5431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Gm5431 APN 11 48895414 missense probably benign 0.09
IGL00964:Gm5431 APN 11 48889267 missense probably damaging 0.99
IGL01571:Gm5431 APN 11 48894713 missense probably benign 0.00
IGL02006:Gm5431 APN 11 48888503 missense probably damaging 1.00
IGL02084:Gm5431 APN 11 48889085 missense probably benign 0.41
IGL02255:Gm5431 APN 11 48888958 missense possibly damaging 0.93
IGL02291:Gm5431 APN 11 48888964 missense probably damaging 1.00
IGL03194:Gm5431 APN 11 48895537 intron probably benign
IGL03251:Gm5431 APN 11 48894721 missense probably benign 0.00
R1168:Gm5431 UTSW 11 48895364 missense probably benign 0.36
R1387:Gm5431 UTSW 11 48895015 missense possibly damaging 0.92
R1396:Gm5431 UTSW 11 48895434 intron probably benign
R1711:Gm5431 UTSW 11 48895026 missense possibly damaging 0.73
R1750:Gm5431 UTSW 11 48894831 missense probably benign 0.01
R1927:Gm5431 UTSW 11 48889255 missense probably damaging 1.00
R1957:Gm5431 UTSW 11 48888397 nonsense probably null
R2196:Gm5431 UTSW 11 48889231 missense probably damaging 1.00
R2509:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R2511:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R4018:Gm5431 UTSW 11 48889168 missense probably damaging 1.00
R4859:Gm5431 UTSW 11 48889582 missense probably damaging 1.00
R4895:Gm5431 UTSW 11 48889028 missense probably damaging 0.98
R5124:Gm5431 UTSW 11 48889039 missense probably benign 0.31
R5311:Gm5431 UTSW 11 48888889 missense probably damaging 1.00
R5600:Gm5431 UTSW 11 48894756 missense possibly damaging 0.56
R5728:Gm5431 UTSW 11 48888613 missense probably damaging 1.00
R5731:Gm5431 UTSW 11 48894448 missense probably damaging 0.96
R6120:Gm5431 UTSW 11 48894781 missense probably benign 0.36
R6169:Gm5431 UTSW 11 48888575 missense probably benign 0.29
R6192:Gm5431 UTSW 11 48894393 missense probably benign 0.01
R6253:Gm5431 UTSW 11 48894999 missense probably benign 0.00
R6326:Gm5431 UTSW 11 48889345 missense probably damaging 1.00
R6401:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R6654:Gm5431 UTSW 11 48894600 missense possibly damaging 0.91
R6810:Gm5431 UTSW 11 48888976 missense probably damaging 1.00
R6965:Gm5431 UTSW 11 48895200 missense probably benign 0.19
R6970:Gm5431 UTSW 11 48888490 missense probably damaging 1.00
R7269:Gm5431 UTSW 11 48888410 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCAAGGCATTGATGAAGCTGG -3'
(R):5'- TAGTAATGGTATCAGCAGCTGAGC -3'

Sequencing Primer
(F):5'- CATTGATGAAGCTGGATTTCCC -3'
(R):5'- GAACAAATTCCTAGGCCTTGC -3'
Posted On2017-10-10