Incidental Mutation 'R6129:Prps1l1'
ID487586
Institutional Source Beutler Lab
Gene Symbol Prps1l1
Ensembl Gene ENSMUSG00000092305
Gene Namephosphoribosyl pyrophosphate synthetase 1-like 1
Synonyms
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location34984761-34986436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34985330 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 148 (E148G)
Ref Sequence ENSEMBL: ENSMUSP00000133931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134550]
Predicted Effect probably damaging
Transcript: ENSMUST00000134550
AA Change: E148G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133931
Gene: ENSMUSG00000092305
AA Change: E148G

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 4 120 7.1e-49 PFAM
Pfam:Pribosyltran 139 261 1.5e-15 PFAM
Pfam:Pribosyl_synth 200 314 2.8e-39 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is specifically expressed in the testis, and encodes a protein that is highly homologous to the two subunits of phosphoribosylpyrophosphate synthetase encoded by human X-linked genes, PRPS1 and PRPS2. These enzymes convert pyrimidine, purine or pyridine bases to the corresponding ribonucleoside monophosphates. In vitro transcription/translation and site-directed mutagenesis studies indicate that translation of this mRNA initiates exclusively at a non-AUG (ACG) codon. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Prps1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Prps1l1 APN 12 34985378 missense probably benign 0.09
IGL01375:Prps1l1 APN 12 34985632 missense possibly damaging 0.78
R0379:Prps1l1 UTSW 12 34985078 missense probably benign 0.33
R2109:Prps1l1 UTSW 12 34985522 missense probably benign
R3909:Prps1l1 UTSW 12 34985798 missense possibly damaging 0.84
R7284:Prps1l1 UTSW 12 34985318 missense possibly damaging 0.65
R7295:Prps1l1 UTSW 12 34985680 missense probably benign
R7374:Prps1l1 UTSW 12 34985425 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GATCATGATCAATGCCTGCAAG -3'
(R):5'- ATGCGGTCCACTTCATTGGC -3'

Sequencing Primer
(F):5'- ATGCCTGCAAGATCGCTTCAG -3'
(R):5'- CTTTCTTCCGTTCTTTGTGAATCAAG -3'
Posted On2017-10-10