Incidental Mutation 'R6129:Bcl2l2'
ID487593
Institutional Source Beutler Lab
Gene Symbol Bcl2l2
Ensembl Gene ENSMUSG00000089682
Gene NameBCL2-like 2
SynonymsGtrosa41, bclw, Bcl-w, Gtrgal2
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54883377-54888234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54884745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 122 (V122M)
Ref Sequence ENSEMBL: ENSMUSP00000117229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022806] [ENSMUST00000133397] [ENSMUST00000134077] [ENSMUST00000172844] [ENSMUST00000227108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022806
AA Change: V122M

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022806
Gene: ENSMUSG00000089682
AA Change: V122M

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 172 188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131243
Predicted Effect possibly damaging
Transcript: ENSMUST00000133397
AA Change: V122M

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116385
Gene: ENSMUSG00000089682
AA Change: V122M

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134077
AA Change: V122M

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232
AA Change: V122M

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172844
AA Change: V8M

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133286
Gene: ENSMUSG00000089682
AA Change: V8M

DomainStartEndE-ValueType
Pfam:Bcl-2 1 30 3.9e-7 PFAM
Blast:BCL 31 53 1e-7 BLAST
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227108
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mutants are male sterile with progressive loss of germ cells, Sertoli cells and Leydig cells beginning at puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Bcl2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03126:Bcl2l2 APN 14 54884767 missense probably damaging 1.00
R2656:Bcl2l2 UTSW 14 54885432 missense probably benign 0.02
R4042:Bcl2l2 UTSW 14 54884634 missense possibly damaging 0.82
R5278:Bcl2l2 UTSW 14 54884794 missense probably damaging 0.98
R6234:Bcl2l2 UTSW 14 54884788 missense probably benign 0.00
R7205:Bcl2l2 UTSW 14 54884601 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACGAGTTTGAGACCCGTTTC -3'
(R):5'- TCCACTTAAATAAGGGAACTCAGC -3'

Sequencing Primer
(F):5'- TTGAGACCCGTTTCCGCCG -3'
(R):5'- GGAACTCAGCCCTTCCCAG -3'
Posted On2017-10-10