Incidental Mutation 'R6183:Iqcg'
ID487643
Institutional Source Beutler Lab
Gene Symbol Iqcg
Ensembl Gene ENSMUSG00000035578
Gene NameIQ motif containing G
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6183 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33012683-33056218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33030923 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 226 (Y226C)
Ref Sequence ENSEMBL: ENSMUSP00000110752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115100]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably damaging
Transcript: ENSMUST00000115100
AA Change: Y226C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110752
Gene: ENSMUSG00000035578
AA Change: Y226C

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
coiled coil region 248 329 N/A INTRINSIC
IQ 371 393 1.54e-2 SMART
low complexity region 399 419 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231235
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous male mice are infertile and have very low epididymal sperm concentration with low motility, predominantly appearing as sperm heads without tails or with short tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Iqcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Iqcg APN 16 33035600 missense possibly damaging 0.90
IGL01155:Iqcg APN 16 33040875 missense probably damaging 0.99
IGL01602:Iqcg APN 16 33016978 unclassified probably benign
IGL01605:Iqcg APN 16 33016978 unclassified probably benign
IGL02243:Iqcg APN 16 33045592 missense probably damaging 1.00
IGL02328:Iqcg APN 16 33019506 missense probably benign 0.00
IGL02490:Iqcg APN 16 33035567 nonsense probably null
IGL03297:Iqcg APN 16 33035632 splice site probably benign
R0038:Iqcg UTSW 16 33045642 missense probably benign 0.03
R0453:Iqcg UTSW 16 33049843 splice site probably benign
R0719:Iqcg UTSW 16 33040845 missense probably benign 0.26
R1191:Iqcg UTSW 16 33049943 missense probably benign 0.43
R1544:Iqcg UTSW 16 33045525 missense probably benign 0.01
R2292:Iqcg UTSW 16 33049883 missense probably benign 0.25
R3725:Iqcg UTSW 16 33020539 unclassified probably null
R3726:Iqcg UTSW 16 33029041 missense probably damaging 1.00
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3733:Iqcg UTSW 16 33053626 unclassified probably benign
R3734:Iqcg UTSW 16 33053626 unclassified probably benign
R3770:Iqcg UTSW 16 33050008 synonymous silent
R4296:Iqcg UTSW 16 33016975 unclassified probably benign
R4409:Iqcg UTSW 16 33045518 critical splice donor site probably null
R4410:Iqcg UTSW 16 33030816 missense possibly damaging 0.95
R4429:Iqcg UTSW 16 33019490 missense probably benign 0.02
R4603:Iqcg UTSW 16 33040764 missense probably null 0.68
R4603:Iqcg UTSW 16 33040763 critical splice donor site probably null
R4979:Iqcg UTSW 16 33019514 missense probably damaging 1.00
R5672:Iqcg UTSW 16 33019508 missense probably damaging 0.99
R6965:Iqcg UTSW 16 33030804 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACAGCCTAATGTAGCACAAGT -3'
(R):5'- TTTATTATCCTGCGTGGGAGAA -3'

Sequencing Primer
(F):5'- GCCTAATGTAGCACAAGTTACCTC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2017-10-10