Incidental Mutation 'R6175:Dnah7a'
ID487654
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 044317-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R6175 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53433022 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 3529 (P3529S)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably damaging
Transcript: ENSMUST00000094964
AA Change: P3529S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: P3529S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgb A T 10: 10,398,943 S755T possibly damaging Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Brd9 A T 13: 73,960,314 E589D probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Cdh22 G T 2: 165,146,630 N268K probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nlrp9c T C 7: 26,378,001 probably null Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Slc7a9 A T 7: 35,465,852 Q474L probably damaging Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
St13 A G 15: 81,399,305 probably null Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Tln2 T A 9: 67,224,081 K1394N probably damaging Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense not run
R7096:Dnah7a UTSW 1 53483440 missense not run
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTGCTTTACAGGGCTGG -3'
(R):5'- AGCAAGGAATGTTGGGCTTC -3'

Sequencing Primer
(F):5'- CTTTACAGGGCTGGGGTGACAG -3'
(R):5'- GGCTTCTGCTTAAGTTGCAAC -3'
Posted On2017-10-10