Incidental Mutation 'R6175:Tln2'
ID487700
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R6175 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67224081 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1394 (K1394N)
Ref Sequence ENSEMBL: ENSMUSP00000149474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]
Predicted Effect probably damaging
Transcript: ENSMUST00000039662
AA Change: K2465N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: K2465N

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040025
AA Change: K2465N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: K2465N

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000214859
AA Change: K845N
Predicted Effect probably damaging
Transcript: ENSMUST00000215267
AA Change: K1375N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215784
AA Change: K2467N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216799
Predicted Effect probably damaging
Transcript: ENSMUST00000217550
AA Change: K1394N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgb A T 10: 10,398,943 S755T possibly damaging Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Brd9 A T 13: 73,960,314 E589D probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Cdh22 G T 2: 165,146,630 N268K probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah7a G A 1: 53,433,022 P3529S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nlrp9c T C 7: 26,378,001 probably null Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Slc7a9 A T 7: 35,465,852 Q474L probably damaging Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
St13 A G 15: 81,399,305 probably null Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCAGAGATGGACTTGC -3'
(R):5'- AAAGAGCCGTACTTAGCCGTC -3'

Sequencing Primer
(F):5'- CAGAGATGGACTTGCATCCTG -3'
(R):5'- CCGTACTTAGCCGTCAGTGTTG -3'
Posted On2017-10-10