Incidental Mutation 'R6176:Usp53'
ID487742
Institutional Source Beutler Lab
Gene Symbol Usp53
Ensembl Gene ENSMUSG00000039701
Gene Nameubiquitin specific peptidase 53
SynonymsPhxr3, Sp6
MMRRC Submission 044318-MU
Accession Numbers

Ncbi RefSeq: NM_133857.3; MGI: 2139607

Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6176 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location122931493-122984510 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 122934003 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 977 (Q977*)
Ref Sequence ENSEMBL: ENSMUSP00000087857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090379]
Predicted Effect probably null
Transcript: ENSMUST00000090379
AA Change: Q977*
SMART Domains Protein: ENSMUSP00000087857
Gene: ENSMUSG00000039701
AA Change: Q977*

DomainStartEndE-ValueType
Pfam:UCH 29 348 1.6e-20 PFAM
Pfam:UCH_1 30 322 9.6e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss associated with altered cochlear outer hair cell (OHC) morphology, reduced endocochlear potential, and early OHC loss followed by IHC and spiral ganglion degeneration. Heterozygotes are susceptible to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(48) : Gene trapped(48)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,377,732 Q966R probably benign Het
Amn A G 12: 111,274,156 D74G possibly damaging Het
Ank2 T A 3: 126,945,471 T2255S probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Apaf1 A G 10: 91,059,571 probably null Het
Asl T A 5: 130,018,879 H82L probably benign Het
Atrn A G 2: 130,946,091 E271G probably benign Het
B4galnt3 A G 6: 120,224,164 F184S probably damaging Het
C1s2 T A 6: 124,625,809 H481L probably damaging Het
Cav2 A G 6: 17,286,919 D58G possibly damaging Het
Cc2d2a A T 5: 43,709,113 H755L probably benign Het
Ccdc65 A G 15: 98,708,552 probably null Het
Celsr3 A T 9: 108,828,355 Y679F probably damaging Het
Cep135 A T 5: 76,624,643 Y625F probably benign Het
Cfhr1 A G 1: 139,550,916 S58P probably damaging Het
Clip4 T A 17: 71,806,633 C259* probably null Het
Cyp2j12 T A 4: 96,140,837 Q69L probably damaging Het
Dirc2 C T 16: 35,704,797 M426I probably benign Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Ecscr CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 18: 35,716,760 probably benign Het
Fam43b T C 4: 138,395,211 D266G probably damaging Het
Fbxl13 T A 5: 21,500,500 I618F possibly damaging Het
Gm10229 T A 16: 89,015,400 Y24* probably null Het
Gm11639 A T 11: 104,792,557 I1604F probably benign Het
Gm13212 T A 4: 145,624,058 C688* probably null Het
Gne C T 4: 44,053,019 probably benign Het
Gnpat T A 8: 124,878,854 V321E probably damaging Het
Gpatch8 G A 11: 102,487,524 A200V unknown Het
Grid1 C A 14: 35,562,547 A749E probably benign Het
Grip2 C T 6: 91,779,851 V540I probably benign Het
Ice2 C T 9: 69,417,072 T759M probably damaging Het
Jrk G T 15: 74,706,340 N365K possibly damaging Het
Kank4 A G 4: 98,765,554 I879T probably damaging Het
Lao1 T A 4: 118,962,000 M1K probably null Het
Mlf1 A G 3: 67,384,594 R31G probably damaging Het
Nt5c3b T C 11: 100,440,148 probably benign Het
Nusap1 A G 2: 119,630,421 R132G probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1153 G A 2: 87,896,936 V254I probably benign Het
Olfr738 A G 14: 50,414,390 Y282C probably damaging Het
Olfr926 A C 9: 38,877,377 D67A probably damaging Het
Paqr9 G T 9: 95,560,775 V273L possibly damaging Het
Pcdha9 A T 18: 36,998,931 D351V probably benign Het
Pcdhga1 A G 18: 37,664,229 D762G probably benign Het
Pde3a T A 6: 141,498,889 L1141Q possibly damaging Het
Pga5 T A 19: 10,671,785 probably null Het
Phldb3 C A 7: 24,626,702 R570S probably damaging Het
Slc22a6 A C 19: 8,621,797 E264A probably damaging Het
Slit1 T C 19: 41,637,595 K576R probably damaging Het
Sox21 T C 14: 118,235,628 K3R possibly damaging Het
Stk32c A T 7: 139,120,775 D297E probably benign Het
Suclg1 T C 6: 73,275,343 V323A probably damaging Het
Tas1r2 T G 4: 139,668,888 C513G probably damaging Het
Tbc1d23 A G 16: 57,171,789 Y603H probably damaging Het
Tbc1d31 T C 15: 57,952,796 V642A probably damaging Het
Tle2 A T 10: 81,587,334 D486V probably damaging Het
Tmem232 A G 17: 65,485,872 I110T probably damaging Het
Tmem39b A G 4: 129,693,101 Y106H probably damaging Het
Trpm4 T G 7: 45,326,676 N229T probably damaging Het
Tspo A G 15: 83,573,806 T120A probably benign Het
Ttc28 G A 5: 111,223,985 A767T probably damaging Het
Vmn1r215 T A 13: 23,076,358 D189E probably damaging Het
Vmn2r12 T C 5: 109,086,000 Y782C probably benign Het
Vmn2r54 A G 7: 12,615,981 L558P probably damaging Het
Other mutations in Usp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Usp53 APN 3 122957718 missense probably damaging 0.99
IGL01965:Usp53 APN 3 122961153 critical splice donor site probably null
IGL02115:Usp53 APN 3 122947390 missense probably benign 0.25
IGL02993:Usp53 APN 3 122933843 missense probably damaging 1.00
IGL03119:Usp53 APN 3 122961415 missense possibly damaging 0.80
IGL03206:Usp53 APN 3 122953183 missense probably benign
IGL03369:Usp53 APN 3 122933721 utr 3 prime probably benign
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0366:Usp53 UTSW 3 122949201 missense probably damaging 1.00
R1015:Usp53 UTSW 3 122933759 missense probably benign 0.02
R1388:Usp53 UTSW 3 122957628 missense probably damaging 0.96
R1592:Usp53 UTSW 3 122934050 nonsense probably null
R1635:Usp53 UTSW 3 122934223 missense probably benign 0.03
R1707:Usp53 UTSW 3 122947400 missense probably benign
R2177:Usp53 UTSW 3 122936057 missense probably damaging 0.99
R2848:Usp53 UTSW 3 122934491 missense probably benign 0.00
R2898:Usp53 UTSW 3 122957574 nonsense probably null
R3411:Usp53 UTSW 3 122949858 critical splice acceptor site probably null
R3618:Usp53 UTSW 3 122934412 missense probably benign 0.25
R3713:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3715:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3923:Usp53 UTSW 3 122934305 missense probably benign 0.11
R4616:Usp53 UTSW 3 122959120 missense probably damaging 1.00
R4718:Usp53 UTSW 3 122933982 missense probably benign 0.22
R4730:Usp53 UTSW 3 122962933 missense probably null 0.82
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R5073:Usp53 UTSW 3 122933946 missense probably benign 0.21
R5580:Usp53 UTSW 3 122934234 missense probably benign 0.00
R5894:Usp53 UTSW 3 122959085 missense probably damaging 0.96
R6191:Usp53 UTSW 3 122949741 missense probably damaging 0.96
R6634:Usp53 UTSW 3 122964286 missense probably benign 0.00
R7179:Usp53 UTSW 3 122949710 missense probably benign 0.01
R7211:Usp53 UTSW 3 122957650 missense probably damaging 0.98
X0025:Usp53 UTSW 3 122957583 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTATCAGTCATGCAACTATCAAC -3'
(R):5'- TGCCTGCAATGCTGATAGTTG -3'

Sequencing Primer
(F):5'- CATGCAACTATCAACTGAGAAATAGG -3'
(R):5'- CAATGCTGATAGTTGTCAGATGCC -3'
Posted On2017-10-10