Incidental Mutation 'R6176:Cc2d2a'
ID487753
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission 044318-MU
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R6176 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43709113 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 755 (H755L)
Ref Sequence ENSEMBL: ENSMUSP00000114349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect probably benign
Transcript: ENSMUST00000048150
AA Change: H804L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: H804L

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125866
AA Change: H755L

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: H755L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127355
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,377,732 Q966R probably benign Het
Amn A G 12: 111,274,156 D74G possibly damaging Het
Ank2 T A 3: 126,945,471 T2255S probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Apaf1 A G 10: 91,059,571 probably null Het
Asl T A 5: 130,018,879 H82L probably benign Het
Atrn A G 2: 130,946,091 E271G probably benign Het
B4galnt3 A G 6: 120,224,164 F184S probably damaging Het
C1s2 T A 6: 124,625,809 H481L probably damaging Het
Cav2 A G 6: 17,286,919 D58G possibly damaging Het
Ccdc65 A G 15: 98,708,552 probably null Het
Celsr3 A T 9: 108,828,355 Y679F probably damaging Het
Cep135 A T 5: 76,624,643 Y625F probably benign Het
Cfhr1 A G 1: 139,550,916 S58P probably damaging Het
Clip4 T A 17: 71,806,633 C259* probably null Het
Cyp2j12 T A 4: 96,140,837 Q69L probably damaging Het
Dirc2 C T 16: 35,704,797 M426I probably benign Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Ecscr CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 18: 35,716,760 probably benign Het
Fam43b T C 4: 138,395,211 D266G probably damaging Het
Fbxl13 T A 5: 21,500,500 I618F possibly damaging Het
Gm10229 T A 16: 89,015,400 Y24* probably null Het
Gm11639 A T 11: 104,792,557 I1604F probably benign Het
Gm13212 T A 4: 145,624,058 C688* probably null Het
Gne C T 4: 44,053,019 probably benign Het
Gnpat T A 8: 124,878,854 V321E probably damaging Het
Gpatch8 G A 11: 102,487,524 A200V unknown Het
Grid1 C A 14: 35,562,547 A749E probably benign Het
Grip2 C T 6: 91,779,851 V540I probably benign Het
Ice2 C T 9: 69,417,072 T759M probably damaging Het
Jrk G T 15: 74,706,340 N365K possibly damaging Het
Kank4 A G 4: 98,765,554 I879T probably damaging Het
Lao1 T A 4: 118,962,000 M1K probably null Het
Mlf1 A G 3: 67,384,594 R31G probably damaging Het
Nt5c3b T C 11: 100,440,148 probably benign Het
Nusap1 A G 2: 119,630,421 R132G probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1153 G A 2: 87,896,936 V254I probably benign Het
Olfr738 A G 14: 50,414,390 Y282C probably damaging Het
Olfr926 A C 9: 38,877,377 D67A probably damaging Het
Paqr9 G T 9: 95,560,775 V273L possibly damaging Het
Pcdha9 A T 18: 36,998,931 D351V probably benign Het
Pcdhga1 A G 18: 37,664,229 D762G probably benign Het
Pde3a T A 6: 141,498,889 L1141Q possibly damaging Het
Pga5 T A 19: 10,671,785 probably null Het
Phldb3 C A 7: 24,626,702 R570S probably damaging Het
Slc22a6 A C 19: 8,621,797 E264A probably damaging Het
Slit1 T C 19: 41,637,595 K576R probably damaging Het
Sox21 T C 14: 118,235,628 K3R possibly damaging Het
Stk32c A T 7: 139,120,775 D297E probably benign Het
Suclg1 T C 6: 73,275,343 V323A probably damaging Het
Tas1r2 T G 4: 139,668,888 C513G probably damaging Het
Tbc1d23 A G 16: 57,171,789 Y603H probably damaging Het
Tbc1d31 T C 15: 57,952,796 V642A probably damaging Het
Tle2 A T 10: 81,587,334 D486V probably damaging Het
Tmem232 A G 17: 65,485,872 I110T probably damaging Het
Tmem39b A G 4: 129,693,101 Y106H probably damaging Het
Trpm4 T G 7: 45,326,676 N229T probably damaging Het
Tspo A G 15: 83,573,806 T120A probably benign Het
Ttc28 G A 5: 111,223,985 A767T probably damaging Het
Usp53 G A 3: 122,934,003 Q977* probably null Het
Vmn1r215 T A 13: 23,076,358 D189E probably damaging Het
Vmn2r12 T C 5: 109,086,000 Y782C probably benign Het
Vmn2r54 A G 7: 12,615,981 L558P probably damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAGCATGCACTCTCAC -3'
(R):5'- CCCGTGTCTCTAATATAGTCACCAG -3'

Sequencing Primer
(F):5'- GAGCATGCACTCTCACCTCCC -3'
(R):5'- CACCAGTTCATTCTAATATAGTCACC -3'
Posted On2017-10-10