Incidental Mutation 'R6177:Hmcn2'
ID487800
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Namehemicentin 2
Synonyms
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6177 (G1)
Quality Score161.009
Status Validated
Chromosome2
Chromosomal Location31314415-31460738 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 31420106 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 3264 (L3264*)
Ref Sequence ENSEMBL: ENSMUSP00000109160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
Predicted Effect probably null
Transcript: ENSMUST00000113532
AA Change: L3264*
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: L3264*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226996
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31343096 missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31428994 missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31383821 intron probably benign
IGL01364:Hmcn2 APN 2 31361814 nonsense probably null
IGL01486:Hmcn2 APN 2 31336621 missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31354264 missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31424252 missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31343102 missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31405630 missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31398917 missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31428982 missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31457173 missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31400127 missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31424377 missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31453605 missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31450952 missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31420095 missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31454811 missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31408973 missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31405528 missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31346590 missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31413367 nonsense probably null
IGL03003:Hmcn2 APN 2 31433486 missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31346630 missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31362230 missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31346621 missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31346637 missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31428250 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31388344 missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31426198 missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31438331 critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31369164 splice site probably benign
R0266:Hmcn2 UTSW 2 31394827 missense probably benign 0.03
R0266:Hmcn2 UTSW 2 31445353 splice site probably benign
R0326:Hmcn2 UTSW 2 31423225 nonsense probably null
R0366:Hmcn2 UTSW 2 31424206 missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31400129 missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31388247 missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31405612 missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31415284 critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31386677 missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31415236 missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31453160 missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31391511 missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31346495 missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31314479 missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31420407 missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31430787 missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31458039 missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31450844 missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31354721 missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31457985 missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31396120 missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31314590 missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31393043 missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31383692 missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31415283 critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31411910 critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31389329 missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31438255 missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31335436 missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31378282 missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31380419 missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31333931 splice site probably benign
R2155:Hmcn2 UTSW 2 31460349 missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31380281 missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31419935 missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31380297 missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31350574 missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31335412 critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31388298 missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31460210 missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31360998 missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31400255 missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31433272 splice site probably benign
R3429:Hmcn2 UTSW 2 31409144 missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31336612 nonsense probably null
R3739:Hmcn2 UTSW 2 31336612 nonsense probably null
R3771:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31352885 splice site probably null
R3837:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31430350 missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31453157 missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31380484 critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31382394 missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31336612 nonsense probably null
R4057:Hmcn2 UTSW 2 31400238 missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31413265 missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31396710 missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31399019 missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31438285 missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31383775 missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31445314 missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31360980 missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31335492 missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31354164 critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31344096 missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31393025 missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31458055 critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31401708 missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31409081 missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31458049 missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31389443 missense probably null
R5232:Hmcn2 UTSW 2 31457748 missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31414716 missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31430441 missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31409011 missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31346617 missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31336544 missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31420363 missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31406416 missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31393054 nonsense probably null
R5492:Hmcn2 UTSW 2 31420306 missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31414525 critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31414526 critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31344047 missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31428303 missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31333881 missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31420812 missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31336567 missense probably damaging 1.00
R5716:Hmcn2 UTSW 2 31458738 missense possibly damaging 0.68
R5725:Hmcn2 UTSW 2 31383815 critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31414568 missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31409135 missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31457807 missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31354673 missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31396139 missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31420323 missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31420309 missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31370792 missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31434713 missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31356254 missense probably benign
R6166:Hmcn2 UTSW 2 31369262 missense probably damaging 1.00
R6191:Hmcn2 UTSW 2 31458746 missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31384115 missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31411834 missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31388373 missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31369257 missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31420820 missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31361800 missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31425468 missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31382478 missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31356342 missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31415268 missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31343056 missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31350505 splice site probably null
R6971:Hmcn2 UTSW 2 31432321 missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31422649 missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31360896 missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31457966 missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31343081 missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31459081 missense probably damaging 0.99
X0066:Hmcn2 UTSW 2 31454811 missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31405867 missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31381067 missense probably benign 0.01
Z1088:Hmcn2 UTSW 2 31459064 intron probably null
Predicted Primers PCR Primer
(F):5'- CCGCAAAGACTTTGTAGTGTC -3'
(R):5'- GCTGTTCTTAGGCCCTTCAG -3'

Sequencing Primer
(F):5'- CGCAAAGACTTTGTAGTGTCTGTCC -3'
(R):5'- GTACTGCCGTCCAGATAGAACCTG -3'
Posted On2017-10-10