Incidental Mutation 'R6178:Tgfb1i1'
ID487876
Institutional Source Beutler Lab
Gene Symbol Tgfb1i1
Ensembl Gene ENSMUSG00000030782
Gene Nametransforming growth factor beta 1 induced transcript 1
SynonymsARA55, TSC-5, hic-5
MMRRC Submission 044320-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R6178 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128246812-128255699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128253345 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 478 (F478L)
Ref Sequence ENSEMBL: ENSMUSP00000130964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070656] [ENSMUST00000163609] [ENSMUST00000164710] [ENSMUST00000165667] [ENSMUST00000167965] [ENSMUST00000169919] [ENSMUST00000170115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070656
AA Change: F439L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068529
Gene: ENSMUSG00000030782
AA Change: F439L

DomainStartEndE-ValueType
Pfam:Paxillin 19 183 1.7e-7 PFAM
LIM 210 261 5.18e-22 SMART
LIM 269 320 4.37e-20 SMART
LIM 328 379 3.69e-18 SMART
LIM 387 438 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163553
Predicted Effect possibly damaging
Transcript: ENSMUST00000163609
AA Change: F345L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133134
Gene: ENSMUSG00000030782
AA Change: F345L

DomainStartEndE-ValueType
low complexity region 11 44 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
LIM 116 167 5.18e-22 SMART
LIM 175 226 4.37e-20 SMART
LIM 234 285 3.69e-18 SMART
LIM 293 344 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164710
AA Change: F478L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130964
Gene: ENSMUSG00000030782
AA Change: F478L

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 28 48 N/A INTRINSIC
Pfam:Paxillin 49 178 1.4e-10 PFAM
low complexity region 197 209 N/A INTRINSIC
LIM 249 300 5.18e-22 SMART
LIM 308 359 4.37e-20 SMART
LIM 367 418 3.69e-18 SMART
LIM 426 477 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165667
AA Change: F417L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127695
Gene: ENSMUSG00000030782
AA Change: F417L

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 27 37 N/A INTRINSIC
low complexity region 83 116 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
LIM 188 239 5.18e-22 SMART
LIM 247 298 4.37e-20 SMART
LIM 306 357 3.69e-18 SMART
LIM 365 416 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166755
Predicted Effect possibly damaging
Transcript: ENSMUST00000167965
AA Change: F456L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132100
Gene: ENSMUSG00000030782
AA Change: F456L

DomainStartEndE-ValueType
Pfam:Paxillin 34 200 7.3e-8 PFAM
LIM 227 278 5.18e-22 SMART
LIM 286 337 4.37e-20 SMART
LIM 345 396 3.69e-18 SMART
LIM 404 455 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168825
SMART Domains Protein: ENSMUSP00000132685
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
LIM 165 216 5.18e-22 SMART
LIM 224 275 4.37e-20 SMART
LIM 283 334 3.69e-18 SMART
LIM 342 393 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169919
SMART Domains Protein: ENSMUSP00000131705
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 44 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170115
SMART Domains Protein: ENSMUSP00000129958
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
Pfam:Paxillin 17 112 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206691
Meta Mutation Damage Score 0.464 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal response to wire injury of femoral arteries and increased VSMC apoptosis in response to wire injury or mechanical stress. Mice homozygous for a different knock-out allele show normal platelet integrin function both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,029,044 I61V probably benign Het
Afg3l2 G A 18: 67,409,528 T616I possibly damaging Het
Aktip T C 8: 91,126,043 N195S probably damaging Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Atg7 T A 6: 114,724,895 I621N probably damaging Het
Becn1 T A 11: 101,291,510 I283F probably damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Celsr1 C A 15: 85,901,021 R3004M probably benign Het
Clspn A T 4: 126,577,736 probably null Het
Csmd3 T C 15: 48,673,458 Y116C probably damaging Het
Dcp1a T G 14: 30,523,304 *603G probably null Het
Dmrtc1b C T X: 102,713,563 P205S possibly damaging Het
Fev G T 1: 74,884,539 probably benign Het
Fry T A 5: 150,454,522 V393E probably damaging Het
Gm30646 A G 7: 30,432,656 probably null Het
Gm36028 T C 16: 37,856,060 Y115C probably damaging Het
Gm3676 C T 14: 41,641,495 E175K probably benign Het
Gm4847 T C 1: 166,642,336 Y56C probably damaging Het
Gm5422 T C 10: 31,249,692 noncoding transcript Het
Gstm6 A G 3: 107,941,081 V174A probably benign Het
Isoc1 G T 18: 58,671,592 V191F possibly damaging Het
Kalrn T A 16: 34,053,639 D132V possibly damaging Het
Kcp T C 6: 29,482,888 D1394G possibly damaging Het
March10 T G 11: 105,389,614 D615A probably damaging Het
Mau2 A G 8: 70,042,537 I50T probably damaging Het
Mgp A G 6: 136,872,724 C79R probably damaging Het
Mpdz T A 4: 81,308,365 K1344N probably damaging Het
Mrgpre T A 7: 143,780,971 Y265F possibly damaging Het
Mro G A 18: 73,873,224 V80M possibly damaging Het
Mrpl44 G T 1: 79,778,178 C167F possibly damaging Het
Muc5b A G 7: 141,856,342 M1218V probably null Het
Naa16 T C 14: 79,383,340 I100V possibly damaging Het
Nup205 A T 6: 35,243,843 Y1860F possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1195 T C 2: 88,683,633 Y33C probably damaging Het
Olfr293 A G 7: 86,664,611 I316M probably benign Het
Olfr432 A T 1: 174,050,967 Y198F probably benign Het
Plcb3 A G 19: 6,954,703 probably null Het
Pnpla3 G A 15: 84,180,931 A309T probably benign Het
Ranbp10 A G 8: 105,771,664 S624P possibly damaging Het
Ripor2 T C 13: 24,710,130 S714P possibly damaging Het
Robo4 C T 9: 37,405,630 Q414* probably null Het
Shc2 A G 10: 79,630,120 I161T probably damaging Het
Slc35b2 C T 17: 45,566,376 T143I probably benign Het
Slc39a13 T C 2: 91,068,535 D77G probably damaging Het
Snx6 A C 12: 54,760,464 D243E probably damaging Het
Taar8b A G 10: 24,091,813 V161A probably benign Het
Tbr1 T A 2: 61,804,815 D36E possibly damaging Het
Tdpoz2 T C 3: 93,652,311 N118S probably benign Het
Tmprss11f T C 5: 86,556,978 D27G probably benign Het
Trim30d T G 7: 104,487,995 M1L probably damaging Het
Trpm7 A G 2: 126,837,381 V420A probably damaging Het
Ubap2 G T 4: 41,206,981 P199H probably benign Het
Ubash3b T C 9: 41,014,916 T512A probably damaging Het
Zfp65 G A 13: 67,710,318 P76S probably benign Het
Zic5 A T 14: 122,459,336 H622Q unknown Het
Zpld1 A T 16: 55,233,630 N266K probably damaging Het
Zswim1 A G 2: 164,826,052 probably null Het
Other mutations in Tgfb1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tgfb1i1 APN 7 128252521 missense probably damaging 1.00
IGL01919:Tgfb1i1 APN 7 128248482 splice site probably benign
IGL01996:Tgfb1i1 APN 7 128249292 splice site probably benign
IGL02527:Tgfb1i1 APN 7 128252562 splice site probably benign
IGL02596:Tgfb1i1 APN 7 128248896 start codon destroyed probably null 0.05
IGL03139:Tgfb1i1 APN 7 128249304 missense possibly damaging 0.79
PIT4431001:Tgfb1i1 UTSW 7 128249181 missense probably damaging 1.00
PIT4514001:Tgfb1i1 UTSW 7 128249181 missense probably damaging 1.00
R0114:Tgfb1i1 UTSW 7 128249494 missense probably damaging 1.00
R1833:Tgfb1i1 UTSW 7 128249498 splice site probably benign
R2116:Tgfb1i1 UTSW 7 128252805 missense probably damaging 1.00
R2508:Tgfb1i1 UTSW 7 128248913 unclassified probably null
R4695:Tgfb1i1 UTSW 7 128249176 missense probably damaging 1.00
R4756:Tgfb1i1 UTSW 7 128249399 missense probably damaging 1.00
R4853:Tgfb1i1 UTSW 7 128248668 nonsense probably null
R5024:Tgfb1i1 UTSW 7 128248217 start codon destroyed probably null 0.33
R5770:Tgfb1i1 UTSW 7 128248547 intron probably benign
R5839:Tgfb1i1 UTSW 7 128253365 makesense probably null
R6105:Tgfb1i1 UTSW 7 128248417 splice site probably null
R6310:Tgfb1i1 UTSW 7 128252837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTTCCATGCTCAGCGTG -3'
(R):5'- GCCCTTTCTGAAATTGACAAACC -3'

Sequencing Primer
(F):5'- CATGCTCAGCGTGGTTCG -3'
(R):5'- TTGACAAACCTAGAGCATCTTAGGG -3'
Posted On2017-10-10