Incidental Mutation 'R6178:C4b'
ID487903
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6178 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34733406 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1220 (T1220A)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: T1220A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: T1220A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Meta Mutation Damage Score 0.004 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,029,044 I61V probably benign Het
Afg3l2 G A 18: 67,409,528 T616I possibly damaging Het
Aktip T C 8: 91,126,043 N195S probably damaging Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Atg7 T A 6: 114,724,895 I621N probably damaging Het
Becn1 T A 11: 101,291,510 I283F probably damaging Het
Celsr1 C A 15: 85,901,021 R3004M probably benign Het
Clspn A T 4: 126,577,736 probably null Het
Csmd3 T C 15: 48,673,458 Y116C probably damaging Het
Dcp1a T G 14: 30,523,304 *603G probably null Het
Dmrtc1b C T X: 102,713,563 P205S possibly damaging Het
Fev G T 1: 74,884,539 probably benign Het
Fry T A 5: 150,454,522 V393E probably damaging Het
Gm30646 A G 7: 30,432,656 probably null Het
Gm36028 T C 16: 37,856,060 Y115C probably damaging Het
Gm3676 C T 14: 41,641,495 E175K probably benign Het
Gm4847 T C 1: 166,642,336 Y56C probably damaging Het
Gm5422 T C 10: 31,249,692 noncoding transcript Het
Gstm6 A G 3: 107,941,081 V174A probably benign Het
Isoc1 G T 18: 58,671,592 V191F possibly damaging Het
Kalrn T A 16: 34,053,639 D132V possibly damaging Het
Kcp T C 6: 29,482,888 D1394G possibly damaging Het
March10 T G 11: 105,389,614 D615A probably damaging Het
Mau2 A G 8: 70,042,537 I50T probably damaging Het
Mgp A G 6: 136,872,724 C79R probably damaging Het
Mpdz T A 4: 81,308,365 K1344N probably damaging Het
Mrgpre T A 7: 143,780,971 Y265F possibly damaging Het
Mro G A 18: 73,873,224 V80M possibly damaging Het
Mrpl44 G T 1: 79,778,178 C167F possibly damaging Het
Muc5b A G 7: 141,856,342 M1218V probably null Het
Naa16 T C 14: 79,383,340 I100V possibly damaging Het
Nup205 A T 6: 35,243,843 Y1860F possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1195 T C 2: 88,683,633 Y33C probably damaging Het
Olfr293 A G 7: 86,664,611 I316M probably benign Het
Olfr432 A T 1: 174,050,967 Y198F probably benign Het
Plcb3 A G 19: 6,954,703 probably null Het
Pnpla3 G A 15: 84,180,931 A309T probably benign Het
Ranbp10 A G 8: 105,771,664 S624P possibly damaging Het
Ripor2 T C 13: 24,710,130 S714P possibly damaging Het
Robo4 C T 9: 37,405,630 Q414* probably null Het
Shc2 A G 10: 79,630,120 I161T probably damaging Het
Slc35b2 C T 17: 45,566,376 T143I probably benign Het
Slc39a13 T C 2: 91,068,535 D77G probably damaging Het
Snx6 A C 12: 54,760,464 D243E probably damaging Het
Taar8b A G 10: 24,091,813 V161A probably benign Het
Tbr1 T A 2: 61,804,815 D36E possibly damaging Het
Tdpoz2 T C 3: 93,652,311 N118S probably benign Het
Tgfb1i1 T C 7: 128,253,345 F478L probably damaging Het
Tmprss11f T C 5: 86,556,978 D27G probably benign Het
Trim30d T G 7: 104,487,995 M1L probably damaging Het
Trpm7 A G 2: 126,837,381 V420A probably damaging Het
Ubap2 G T 4: 41,206,981 P199H probably benign Het
Ubash3b T C 9: 41,014,916 T512A probably damaging Het
Zfp65 G A 13: 67,710,318 P76S probably benign Het
Zic5 A T 14: 122,459,336 H622Q unknown Het
Zpld1 A T 16: 55,233,630 N266K probably damaging Het
Zswim1 A G 2: 164,826,052 probably null Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAGTAGAGGTGTTCTAGAAG -3'
(R):5'- GCCTCTGCTCTCTTCTAGGAAG -3'

Sequencing Primer
(F):5'- TGCATACTGAACAAGAAAACTACAGG -3'
(R):5'- TTCTAGGAAGCCTCCATCACC -3'
Posted On2017-10-10