Incidental Mutation 'R6179:Aox4'
ID487910
Institutional Source Beutler Lab
Gene Symbol Aox4
Ensembl Gene ENSMUSG00000038242
Gene Namealdehyde oxidase 4
Synonyms2310003G12Rik, AOH2
MMRRC Submission 044321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6179 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58210397-58268597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58231503 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 280 (D280E)
Ref Sequence ENSEMBL: ENSMUSP00000048929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040442]
Predicted Effect probably benign
Transcript: ENSMUST00000040442
AA Change: D280E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: D280E

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.6e-10 PFAM
Pfam:Fer2_2 91 165 4.6e-30 PFAM
Pfam:FAD_binding_5 240 421 2.7e-47 PFAM
CO_deh_flav_C 428 532 1.19e-26 SMART
Ald_Xan_dh_C 596 699 8.22e-39 SMART
Pfam:Ald_Xan_dh_C2 709 1243 1.1e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161833
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930426L09Rik T C 2: 18,998,842 probably benign Het
4930590J08Rik T C 6: 91,942,330 S657P probably damaging Het
Abca9 T C 11: 110,134,254 I988V probably benign Het
Apob T A 12: 8,005,060 L1353* probably null Het
Atp2b1 C T 10: 99,022,829 R222C probably damaging Het
AW209491 T G 13: 14,637,083 S174A possibly damaging Het
B930094E09Rik G C 18: 31,609,858 probably benign Het
Cbln3 G T 14: 55,884,060 P43Q possibly damaging Het
Ccdc181 A T 1: 164,279,918 T57S probably benign Het
Ccr2 A C 9: 124,105,971 N96T probably damaging Het
Cep131 T C 11: 120,066,011 I868V probably benign Het
Chd2 A G 7: 73,444,323 I1535T probably damaging Het
Chl1 A T 6: 103,683,243 T377S probably benign Het
Cpeb3 A G 19: 37,088,453 F439L probably damaging Het
Crb2 T C 2: 37,790,257 V399A probably damaging Het
Cry2 C T 2: 92,413,842 G329R probably damaging Het
Dock4 A G 12: 40,731,869 E691G probably benign Het
Edil3 A T 13: 88,821,989 H3L probably benign Het
Endod1 T C 9: 14,357,461 I243V probably benign Het
Fpr3 G A 17: 17,970,657 W63* probably null Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gtse1 T G 15: 85,868,957 N424K possibly damaging Het
Kcnt1 G A 2: 25,893,180 V252M probably damaging Het
Kif1bp G A 10: 62,563,250 Q130* probably null Het
Lmbrd2 T G 15: 9,149,175 I48M probably damaging Het
Lrrc7 T G 3: 158,353,432 I13L probably damaging Het
Mbd4 A G 6: 115,845,425 S408P probably benign Het
Mphosph10 A G 7: 64,378,781 V542A possibly damaging Het
Msto1 C A 3: 88,910,947 R331L probably damaging Het
Myh10 G A 11: 68,802,153 E1425K probably damaging Het
Nup43 T C 10: 7,678,673 I340T probably benign Het
Olfr350 T C 2: 36,850,834 S263P possibly damaging Het
Pcm1 T A 8: 41,283,632 M884K probably damaging Het
Phf20 T A 2: 156,298,653 L749H probably damaging Het
Pigp T C 16: 94,370,367 R22G probably null Het
Polr2b T C 5: 77,320,977 M200T probably damaging Het
Ppig T A 2: 69,750,127 D668E unknown Het
Prss3 G A 6: 41,375,126 R68C probably benign Het
Retreg3 G A 11: 101,103,895 probably benign Het
Shank1 T C 7: 44,357,206 F2116L possibly damaging Het
Spg21 T C 9: 65,468,808 S33P possibly damaging Het
Spns3 A G 11: 72,499,523 S432P probably damaging Het
Stra6 A G 9: 58,135,169 E27G probably damaging Het
Tanc1 A G 2: 59,842,976 Q1468R probably benign Het
Tbce T G 13: 14,019,777 E99A probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trim10 A G 17: 36,877,031 T380A probably damaging Het
Trim31 T A 17: 36,909,609 D472E probably damaging Het
Vmn2r28 G A 7: 5,488,004 Q415* probably null Het
Vwf G A 6: 125,649,289 C7Y unknown Het
Yeats2 C T 16: 20,214,475 P1088L probably benign Het
Zfp40 C A 17: 23,178,380 V48L possibly damaging Het
Other mutations in Aox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Aox4 APN 1 58239174 missense probably damaging 1.00
IGL01011:Aox4 APN 1 58240775 nonsense probably null
IGL01634:Aox4 APN 1 58221930 missense possibly damaging 0.81
IGL01689:Aox4 APN 1 58245161 splice site probably benign
IGL01874:Aox4 APN 1 58252084 missense probably damaging 1.00
IGL02104:Aox4 APN 1 58236657 splice site probably benign
IGL02744:Aox4 APN 1 58255552 missense possibly damaging 0.90
IGL02751:Aox4 APN 1 58259052 missense probably damaging 1.00
IGL03225:Aox4 APN 1 58247227 missense possibly damaging 0.94
IGL03247:Aox4 APN 1 58264367 missense probably damaging 1.00
IGL03369:Aox4 APN 1 58262587 missense probably benign 0.01
R0138:Aox4 UTSW 1 58228866 missense probably damaging 1.00
R0243:Aox4 UTSW 1 58213076 missense probably benign
R0368:Aox4 UTSW 1 58213079 missense probably benign 0.07
R0499:Aox4 UTSW 1 58263397 critical splice donor site probably null
R0513:Aox4 UTSW 1 58217519 missense probably benign
R0513:Aox4 UTSW 1 58247300 missense probably damaging 1.00
R0546:Aox4 UTSW 1 58250174 missense probably damaging 1.00
R0591:Aox4 UTSW 1 58239102 splice site probably benign
R0825:Aox4 UTSW 1 58248909 missense possibly damaging 0.55
R1912:Aox4 UTSW 1 58264402 missense probably damaging 1.00
R1934:Aox4 UTSW 1 58245936 missense probably benign 0.01
R2180:Aox4 UTSW 1 58213067 missense probably benign 0.00
R2293:Aox4 UTSW 1 58221937 missense probably damaging 0.99
R3017:Aox4 UTSW 1 58235204 missense probably benign
R3744:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3745:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3830:Aox4 UTSW 1 58255511 missense probably damaging 0.99
R3856:Aox4 UTSW 1 58253934 missense probably damaging 1.00
R4214:Aox4 UTSW 1 58221892 missense probably damaging 0.99
R4484:Aox4 UTSW 1 58262571 missense probably damaging 1.00
R4706:Aox4 UTSW 1 58266787 missense probably damaging 1.00
R4710:Aox4 UTSW 1 58255638 missense probably damaging 1.00
R4729:Aox4 UTSW 1 58259077 nonsense probably null
R4769:Aox4 UTSW 1 58259148 missense probably null 1.00
R4809:Aox4 UTSW 1 58266649 missense probably damaging 1.00
R4989:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5082:Aox4 UTSW 1 58231483 missense possibly damaging 0.63
R5102:Aox4 UTSW 1 58240778 missense probably damaging 1.00
R5114:Aox4 UTSW 1 58246286 missense possibly damaging 0.89
R5133:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5134:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5185:Aox4 UTSW 1 58254318 missense probably damaging 1.00
R5217:Aox4 UTSW 1 58246241 nonsense probably null
R5426:Aox4 UTSW 1 58220094 missense probably damaging 1.00
R5443:Aox4 UTSW 1 58233992 splice site probably null
R5708:Aox4 UTSW 1 58245873 missense possibly damaging 0.69
R6052:Aox4 UTSW 1 58254318 nonsense probably null
R6167:Aox4 UTSW 1 58263935 missense probably damaging 1.00
R6196:Aox4 UTSW 1 58217526 missense probably damaging 1.00
R6513:Aox4 UTSW 1 58213053 missense probably benign 0.01
R6781:Aox4 UTSW 1 58245109 missense probably benign 0.03
R6885:Aox4 UTSW 1 58264378 missense probably damaging 1.00
R7082:Aox4 UTSW 1 58224193 missense possibly damaging 0.82
R7127:Aox4 UTSW 1 58228874 missense probably benign 0.00
R7153:Aox4 UTSW 1 58250219 missense probably damaging 0.99
R7371:Aox4 UTSW 1 58263854 missense probably damaging 1.00
X0021:Aox4 UTSW 1 58247295 nonsense probably null
X0028:Aox4 UTSW 1 58254183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCACAGCTTGTTTCTATTC -3'
(R):5'- TGACACAGCTGAGTGAGGTATTC -3'

Sequencing Primer
(F):5'- CTATTCATGGGACTCAGGCTCG -3'
(R):5'- TAACCACGAAGTCACTGTGAATG -3'
Posted On2017-10-10