Incidental Mutation 'R6179:Prss3'
ID487924
Institutional Source Beutler Lab
Gene Symbol Prss3
Ensembl Gene ENSMUSG00000071519
Gene Nameprotease, serine 3
SynonymsTRY4, Tb, MTG, mesotrypsin, Try3
MMRRC Submission 044321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6179 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location41373814-41377678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41375126 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 68 (R68C)
Ref Sequence ENSEMBL: ENSMUSP00000093702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096003]
Predicted Effect probably benign
Transcript: ENSMUST00000096003
AA Change: R68C

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093702
Gene: ENSMUSG00000071519
AA Change: R68C

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Tryp_SPc 23 239 1.4e-105 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930426L09Rik T C 2: 18,998,842 probably benign Het
4930590J08Rik T C 6: 91,942,330 S657P probably damaging Het
Abca9 T C 11: 110,134,254 I988V probably benign Het
Aox4 T A 1: 58,231,503 D280E probably benign Het
Apob T A 12: 8,005,060 L1353* probably null Het
Atp2b1 C T 10: 99,022,829 R222C probably damaging Het
AW209491 T G 13: 14,637,083 S174A possibly damaging Het
B930094E09Rik G C 18: 31,609,858 probably benign Het
Cbln3 G T 14: 55,884,060 P43Q possibly damaging Het
Ccdc181 A T 1: 164,279,918 T57S probably benign Het
Ccr2 A C 9: 124,105,971 N96T probably damaging Het
Cep131 T C 11: 120,066,011 I868V probably benign Het
Chd2 A G 7: 73,444,323 I1535T probably damaging Het
Chl1 A T 6: 103,683,243 T377S probably benign Het
Cpeb3 A G 19: 37,088,453 F439L probably damaging Het
Crb2 T C 2: 37,790,257 V399A probably damaging Het
Cry2 C T 2: 92,413,842 G329R probably damaging Het
Dock4 A G 12: 40,731,869 E691G probably benign Het
Edil3 A T 13: 88,821,989 H3L probably benign Het
Endod1 T C 9: 14,357,461 I243V probably benign Het
Fpr3 G A 17: 17,970,657 W63* probably null Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gtse1 T G 15: 85,868,957 N424K possibly damaging Het
Kcnt1 G A 2: 25,893,180 V252M probably damaging Het
Kif1bp G A 10: 62,563,250 Q130* probably null Het
Lmbrd2 T G 15: 9,149,175 I48M probably damaging Het
Lrrc7 T G 3: 158,353,432 I13L probably damaging Het
Mbd4 A G 6: 115,845,425 S408P probably benign Het
Mphosph10 A G 7: 64,378,781 V542A possibly damaging Het
Msto1 C A 3: 88,910,947 R331L probably damaging Het
Myh10 G A 11: 68,802,153 E1425K probably damaging Het
Nup43 T C 10: 7,678,673 I340T probably benign Het
Olfr350 T C 2: 36,850,834 S263P possibly damaging Het
Pcm1 T A 8: 41,283,632 M884K probably damaging Het
Phf20 T A 2: 156,298,653 L749H probably damaging Het
Pigp T C 16: 94,370,367 R22G probably null Het
Polr2b T C 5: 77,320,977 M200T probably damaging Het
Ppig T A 2: 69,750,127 D668E unknown Het
Retreg3 G A 11: 101,103,895 probably benign Het
Shank1 T C 7: 44,357,206 F2116L possibly damaging Het
Spg21 T C 9: 65,468,808 S33P possibly damaging Het
Spns3 A G 11: 72,499,523 S432P probably damaging Het
Stra6 A G 9: 58,135,169 E27G probably damaging Het
Tanc1 A G 2: 59,842,976 Q1468R probably benign Het
Tbce T G 13: 14,019,777 E99A probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trim10 A G 17: 36,877,031 T380A probably damaging Het
Trim31 T A 17: 36,909,609 D472E probably damaging Het
Vmn2r28 G A 7: 5,488,004 Q415* probably null Het
Vwf G A 6: 125,649,289 C7Y unknown Het
Yeats2 C T 16: 20,214,475 P1088L probably benign Het
Zfp40 C A 17: 23,178,380 V48L possibly damaging Het
Other mutations in Prss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0535:Prss3 UTSW 6 41374969 missense probably benign 0.26
R1583:Prss3 UTSW 6 41377627 start gained probably benign
R4324:Prss3 UTSW 6 41373845 missense probably benign 0.00
R4859:Prss3 UTSW 6 41373923 missense probably damaging 0.96
R5004:Prss3 UTSW 6 41373902 missense probably damaging 1.00
R5361:Prss3 UTSW 6 41373846 missense probably benign 0.00
R5929:Prss3 UTSW 6 41376804 splice site probably null
R6026:Prss3 UTSW 6 41377554 splice site probably null
R7510:Prss3 UTSW 6 41375110 nonsense probably null
R7514:Prss3 UTSW 6 41373914 missense not run
Predicted Primers PCR Primer
(F):5'- AAAGCTAAGAGTGTTGCCCCAG -3'
(R):5'- TGTCACCTGTACACCATCAC -3'

Sequencing Primer
(F):5'- TGAGACACTGAGTGCCAGC -3'
(R):5'- TGTCACCTGTACACCATCACTCAATC -3'
Posted On2017-10-10