Mutagenetix > Incidental Mutations

Incidental Mutation 'R6181:Cntnap2'

488083

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R6181 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46759808 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 723 (P723S)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

Predicted Effect

probably damaging
Transcript: ENSMUST00000114641
AA Change: P723S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: P723S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,488,055	E384G	probably damaging	Het
Akr1b7	A	G	6: 34,415,378	H42R	possibly damaging	Het
Ankrd26	T	A	6: 118,548,877	H369L	probably benign	Het
Ano7	T	C	1: 93,395,359	S474P	probably damaging	Het
Aox3	T	C	1: 58,158,946	V639A	probably benign	Het
Arhgef2	T	A	3: 88,635,620	V358E	probably damaging	Het
BC017158	A	G	7: 128,297,460		probably null	Het
Brpf3	A	G	17: 28,810,581	Y505C	probably damaging	Het
Casd1	A	G	6: 4,619,331	T120A	probably damaging	Het
Clasp1	T	G	1: 118,419,817	S32A	probably benign	Het
Clca2	A	T	3: 145,090,708	L246*	probably null	Het
Clcn7	A	G	17: 25,151,728	I353V	possibly damaging	Het
Cluap1	T	A	16: 3,933,744	D322E	probably benign	Het
Cmtm4	A	C	8: 104,356,365		probably null	Het
Col6a3	T	A	1: 90,816,374	T84S	possibly damaging	Het
Corin	A	G	5: 72,372,096		probably null	Het
Cubn	G	A	2: 13,349,876	T1903I	probably benign	Het
Cyp27b1	A	C	10: 127,050,410	D320A	probably damaging	Het
Cyp2j6	G	C	4: 96,536,086	L145V	probably damaging	Het
Dennd2a	T	C	6: 39,485,620	K652R	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock1	T	A	7: 135,158,522	M1638K	probably damaging	Het
Eya1	T	C	1: 14,302,872	S8G	probably damaging	Het
Fam193a	T	A	5: 34,443,540		probably null	Het
Fam208a	T	A	14: 27,472,278	M1145K	probably benign	Het
Fbxw11	T	A	11: 32,742,575	N515K	probably benign	Het
Gm11639	T	C	11: 104,831,333	S1924P	probably benign	Het
Gm13083	T	A	4: 143,616,258		probably null	Het
Gm609	A	G	16: 45,417,897	S185P	probably benign	Het
Gm6408	T	C	5: 146,483,772	V154A	possibly damaging	Het
Guf1	A	G	5: 69,561,716	Y235C	probably damaging	Het
Hnrnpul2	C	T	19: 8,823,232	S224L	possibly damaging	Het
Igkv8-19	T	A	6: 70,340,984	D86V	probably damaging	Het
Iqcf1	A	T	9: 106,501,975	D61V	probably damaging	Het
Lrp5	T	C	19: 3,628,427	D476G	probably damaging	Het
Luzp1	A	G	4: 136,543,267	T934A	probably benign	Het
Mboat7	A	T	7: 3,683,885	Y319N	probably benign	Het
Mdn1	A	G	4: 32,715,953	E2045G	probably damaging	Het
Mfsd14b	T	C	13: 65,112,584	R12G	probably benign	Het
Micall2	T	A	5: 139,716,751	T246S	probably benign	Het
Npepps	A	G	11: 97,242,004	V299A	probably damaging	Het
Olfr1381	T	A	11: 49,552,293	V182D	probably damaging	Het
P2ry13	A	G	3: 59,209,907	V150A	probably benign	Het
Pdc	T	C	1: 150,333,270	I168T	probably damaging	Het
Pde8b	C	T	13: 95,086,808	E313K	probably benign	Het
Pgap1	C	T	1: 54,512,777	G499R	probably benign	Het
Ppp1r15b	T	A	1: 133,132,523	C259*	probably null	Het
Ptgs1	A	G	2: 36,251,119	E526G	probably damaging	Het
Ptpn21	A	G	12: 98,699,999	L271P	probably damaging	Het
Rbm47	T	C	5: 66,026,490	T257A	possibly damaging	Het
Rfc3	C	T	5: 151,647,520	D104N	probably damaging	Het
Rhobtb3	A	G	13: 75,910,689	I330T	probably benign	Het
Rnf207	T	C	4: 152,308,848	T570A	probably benign	Het
Sbpl	T	C	17: 23,953,492	H151R	probably damaging	Het
Sstr3	T	C	15: 78,539,461	D362G	probably benign	Het
St7	T	C	6: 17,694,364		probably null	Het
Tdrd6	A	G	17: 43,628,897	V420A	probably damaging	Het
Tet2	C	A	3: 133,487,759	E305*	probably null	Het
Tmem209	A	T	6: 30,505,971	V68E	probably damaging	Het
Tmod4	A	T	3: 95,127,807	I208F	probably damaging	Het
Tpo	G	A	12: 30,131,885	L4F	probably benign	Het
Urb1	T	C	16: 90,779,094	H858R	probably benign	Het
Utrn	A	G	10: 12,739,456	W324R	probably damaging	Het
V1rd19	T	A	7: 24,003,215	F35L	possibly damaging	Het
Vmn1r170	C	A	7: 23,606,267	N31K	probably damaging	Het
Vmn1r192	T	A	13: 22,187,282	Y256F	probably damaging	Het
Vmn2r124	T	C	17: 18,073,757	I702T	possibly damaging	Het
Vmn2r96	G	A	17: 18,583,864	A459T	probably benign	Het
Vwf	G	T	6: 125,566,146	A132S	probably damaging	Het
Zfp202	G	A	9: 40,207,342	G17E	probably damaging	Het
Zfp608	A	G	18: 54,895,628	S1238P	possibly damaging	Het
Zfp804a	G	T	2: 82,257,142	M438I	probably damaging	Het
Zgrf1	G	A	3: 127,587,941	G246S	probably damaging	Het
Zwint	T	C	10: 72,656,599	V115A	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	utr 5 prime	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.27
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ATGGGCATGCATTTGGTCTATC -3'
(R):5'- TGTCTACTAAATTAGCTCCCCACAC -3'

Sequencing Primer
(F):5'- GGTCTATCAGAAACTGCTATAGCTCC -3'
(R):5'- AAATTAGCTCCCCACACTTCTTAC -3'

Posted On

2017-10-10