Incidental Mutation 'R6181:Dock1'
ID488091
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Namededicator of cytokinesis 1
SynonymsD630004B07Rik, Dock180, 9130006G06Rik
MMRRC Submission 044323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6181 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location134670654-135173639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135158522 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1638 (M1638K)
Ref Sequence ENSEMBL: ENSMUSP00000081531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488]
PDB Structure
Solution structure of the SH3 domain of DOCK180 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000084488
AA Change: M1638K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: M1638K

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,488,055 E384G probably damaging Het
Akr1b7 A G 6: 34,415,378 H42R possibly damaging Het
Ankrd26 T A 6: 118,548,877 H369L probably benign Het
Ano7 T C 1: 93,395,359 S474P probably damaging Het
Aox3 T C 1: 58,158,946 V639A probably benign Het
Arhgef2 T A 3: 88,635,620 V358E probably damaging Het
BC017158 A G 7: 128,297,460 probably null Het
Brpf3 A G 17: 28,810,581 Y505C probably damaging Het
Casd1 A G 6: 4,619,331 T120A probably damaging Het
Clasp1 T G 1: 118,419,817 S32A probably benign Het
Clca2 A T 3: 145,090,708 L246* probably null Het
Clcn7 A G 17: 25,151,728 I353V possibly damaging Het
Cluap1 T A 16: 3,933,744 D322E probably benign Het
Cmtm4 A C 8: 104,356,365 probably null Het
Cntnap2 C T 6: 46,759,808 P723S probably damaging Het
Col6a3 T A 1: 90,816,374 T84S possibly damaging Het
Corin A G 5: 72,372,096 probably null Het
Cubn G A 2: 13,349,876 T1903I probably benign Het
Cyp27b1 A C 10: 127,050,410 D320A probably damaging Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dennd2a T C 6: 39,485,620 K652R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eya1 T C 1: 14,302,872 S8G probably damaging Het
Fam193a T A 5: 34,443,540 probably null Het
Fam208a T A 14: 27,472,278 M1145K probably benign Het
Fbxw11 T A 11: 32,742,575 N515K probably benign Het
Gm11639 T C 11: 104,831,333 S1924P probably benign Het
Gm13083 T A 4: 143,616,258 probably null Het
Gm609 A G 16: 45,417,897 S185P probably benign Het
Gm6408 T C 5: 146,483,772 V154A possibly damaging Het
Guf1 A G 5: 69,561,716 Y235C probably damaging Het
Hnrnpul2 C T 19: 8,823,232 S224L possibly damaging Het
Igkv8-19 T A 6: 70,340,984 D86V probably damaging Het
Iqcf1 A T 9: 106,501,975 D61V probably damaging Het
Lrp5 T C 19: 3,628,427 D476G probably damaging Het
Luzp1 A G 4: 136,543,267 T934A probably benign Het
Mboat7 A T 7: 3,683,885 Y319N probably benign Het
Mdn1 A G 4: 32,715,953 E2045G probably damaging Het
Mfsd14b T C 13: 65,112,584 R12G probably benign Het
Micall2 T A 5: 139,716,751 T246S probably benign Het
Npepps A G 11: 97,242,004 V299A probably damaging Het
Olfr1381 T A 11: 49,552,293 V182D probably damaging Het
P2ry13 A G 3: 59,209,907 V150A probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Pde8b C T 13: 95,086,808 E313K probably benign Het
Pgap1 C T 1: 54,512,777 G499R probably benign Het
Ppp1r15b T A 1: 133,132,523 C259* probably null Het
Ptgs1 A G 2: 36,251,119 E526G probably damaging Het
Ptpn21 A G 12: 98,699,999 L271P probably damaging Het
Rbm47 T C 5: 66,026,490 T257A possibly damaging Het
Rfc3 C T 5: 151,647,520 D104N probably damaging Het
Rhobtb3 A G 13: 75,910,689 I330T probably benign Het
Rnf207 T C 4: 152,308,848 T570A probably benign Het
Sbpl T C 17: 23,953,492 H151R probably damaging Het
Sstr3 T C 15: 78,539,461 D362G probably benign Het
St7 T C 6: 17,694,364 probably null Het
Tdrd6 A G 17: 43,628,897 V420A probably damaging Het
Tet2 C A 3: 133,487,759 E305* probably null Het
Tmem209 A T 6: 30,505,971 V68E probably damaging Het
Tmod4 A T 3: 95,127,807 I208F probably damaging Het
Tpo G A 12: 30,131,885 L4F probably benign Het
Urb1 T C 16: 90,779,094 H858R probably benign Het
Utrn A G 10: 12,739,456 W324R probably damaging Het
V1rd19 T A 7: 24,003,215 F35L possibly damaging Het
Vmn1r170 C A 7: 23,606,267 N31K probably damaging Het
Vmn1r192 T A 13: 22,187,282 Y256F probably damaging Het
Vmn2r124 T C 17: 18,073,757 I702T possibly damaging Het
Vmn2r96 G A 17: 18,583,864 A459T probably benign Het
Vwf G T 6: 125,566,146 A132S probably damaging Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp608 A G 18: 54,895,628 S1238P possibly damaging Het
Zfp804a G T 2: 82,257,142 M438I probably damaging Het
Zgrf1 G A 3: 127,587,941 G246S probably damaging Het
Zwint T C 10: 72,656,599 V115A probably benign Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0003:Dock1 UTSW 7 134730064 splice site probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4163:Dock1 UTSW 7 134744322 missense possibly damaging 0.79
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R4953:Dock1 UTSW 7 135152288 missense probably benign 0.34
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6616:Dock1 UTSW 7 135108492 missense possibly damaging 0.85
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 intron probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7259:Dock1 UTSW 7 134782748 missense probably damaging 0.99
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTCTCAAAAGATGTGGAAACTGTC -3'
(R):5'- AAACAGCATGACCAGGATTGC -3'

Sequencing Primer
(F):5'- TTTCCCTTCAGCTCAGAACAAG -3'
(R):5'- ATGACCAGGATTGCTGCGC -3'
Posted On2017-10-10