Incidental Mutation 'R6174:Mcf2l'
ID488199
Institutional Source Beutler Lab
Gene Symbol Mcf2l
Ensembl Gene ENSMUSG00000031442
Gene Namemcf.2 transforming sequence-like
SynonymsC130040G20Rik, Dbs
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6174 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location12873806-13020905 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 13013849 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 1020 (W1020*)
Ref Sequence ENSEMBL: ENSMUSP00000106495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173006] [ENSMUST00000173099]
Predicted Effect probably benign
Transcript: ENSMUST00000095456
SMART Domains Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 75 221 1.77e-24 SMART
SPEC 354 455 4.41e-15 SMART
coiled coil region 507 529 N/A INTRINSIC
low complexity region 578 594 N/A INTRINSIC
RhoGEF 636 811 2.83e-63 SMART
PH 831 948 8.13e-14 SMART
low complexity region 966 978 N/A INTRINSIC
SH3 1058 1115 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098927
SMART Domains Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 49 195 1.77e-24 SMART
SPEC 328 429 4.41e-15 SMART
coiled coil region 481 503 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
RhoGEF 610 785 2.83e-63 SMART
PH 805 922 8.13e-14 SMART
low complexity region 940 952 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110866
SMART Domains Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110867
SMART Domains Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110871
AA Change: W1020*
SMART Domains Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442
AA Change: W1020*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SEC14 43 189 1.77e-24 SMART
SPEC 322 423 4.41e-15 SMART
coiled coil region 475 497 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
RhoGEF 604 779 2.83e-63 SMART
PH 799 916 8.13e-14 SMART
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110873
SMART Domains Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SPEC 165 266 4.41e-15 SMART
coiled coil region 318 340 N/A INTRINSIC
low complexity region 389 405 N/A INTRINSIC
RhoGEF 447 622 2.83e-63 SMART
PH 642 759 8.13e-14 SMART
low complexity region 777 789 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110876
SMART Domains Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1084 1141 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110879
SMART Domains Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1028 1085 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123811
SMART Domains Protein: ENSMUSP00000123434
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
PH 1 88 6.67e-1 SMART
low complexity region 106 118 N/A INTRINSIC
SH3 198 255 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126905
SMART Domains Protein: ENSMUSP00000118540
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SPEC 5 88 8.25e-6 SMART
coiled coil region 139 161 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
RhoGEF 269 444 2.83e-63 SMART
PH 464 581 8.13e-14 SMART
low complexity region 599 611 N/A INTRINSIC
SH3 716 773 3.33e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127229
Predicted Effect probably benign
Transcript: ENSMUST00000134227
SMART Domains Protein: ENSMUSP00000116731
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
Pfam:PH 1 81 1.5e-7 PFAM
low complexity region 101 113 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134989
Predicted Effect probably benign
Transcript: ENSMUST00000139776
SMART Domains Protein: ENSMUSP00000120946
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SH3 99 156 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145067
SMART Domains Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 16 132 2.4e-12 PFAM
SPEC 261 362 4.41e-15 SMART
coiled coil region 414 436 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
RhoGEF 543 718 2.83e-63 SMART
PH 738 855 8.13e-14 SMART
low complexity region 873 885 N/A INTRINSIC
SH3 1021 1078 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145892
SMART Domains Protein: ENSMUSP00000114758
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
Blast:PH 2 23 1e-6 BLAST
PDB:1KZG|C 2 40 1e-19 PDB
SCOP:d1kz7a2 2 40 6e-7 SMART
low complexity region 41 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173006
SMART Domains Protein: ENSMUSP00000134147
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 1 104 1.3e-12 PFAM
SPEC 233 334 4.41e-15 SMART
coiled coil region 386 408 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
RhoGEF 515 690 2.83e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173099
SMART Domains Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 41 187 1.77e-24 SMART
SPEC 320 421 4.41e-15 SMART
coiled coil region 473 495 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
RhoGEF 602 777 2.83e-63 SMART
PH 797 914 8.13e-14 SMART
low complexity region 932 944 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,942,536 D725E probably damaging Het
9530053A07Rik A G 7: 28,139,959 Y399C probably damaging Het
Bco1 T A 8: 117,113,534 Y264N probably damaging Het
Cd109 G A 9: 78,665,546 probably null Het
Cdc45 T C 16: 18,794,704 probably null Het
Ckap5 A G 2: 91,568,219 E578G probably benign Het
Cracr2b T A 7: 141,464,836 L193Q probably damaging Het
D11Wsu47e C A 11: 113,688,975 H399N possibly damaging Het
Dmxl2 G A 9: 54,393,727 L2367F probably damaging Het
Dopey2 T G 16: 93,766,222 D871E probably damaging Het
Emc1 T C 4: 139,366,531 Y651H probably benign Het
Enox1 T C 14: 77,508,187 S41P possibly damaging Het
Foxa1 A G 12: 57,542,900 L178P probably damaging Het
Gm10639 T A 9: 78,304,455 Y166* probably null Het
Grm7 T A 6: 111,246,297 Y433N probably benign Het
Gtf3c2 G A 5: 31,158,211 R813C probably damaging Het
Hacd3 T C 9: 65,005,627 E117G probably damaging Het
Hist1h4i T A 13: 22,041,077 T83S probably benign Het
Hmcn1 G A 1: 150,646,784 T3455M probably benign Het
Itga6 A G 2: 71,833,709 I61V possibly damaging Het
Jaml T C 9: 45,088,773 L81P probably damaging Het
Loxhd1 T C 18: 77,412,178 F782S probably damaging Het
Lrp1b T C 2: 41,449,263 H742R probably benign Het
Macrod2 G T 2: 140,400,975 M1I probably null Het
Msgn1 A G 12: 11,208,923 L9P probably damaging Het
Ngdn C A 14: 55,022,099 S202R probably benign Het
Notch1 C T 2: 26,485,442 G50R possibly damaging Het
Olfr1162 A T 2: 88,050,302 C107* probably null Het
Olfr310 A T 7: 86,268,801 D329E probably benign Het
Olfr43 A T 11: 74,206,640 I192N probably damaging Het
Olfr715b A T 7: 107,106,507 M118K probably damaging Het
Osbpl10 A G 9: 115,109,487 S211G probably benign Het
Pabpc6 G A 17: 9,668,155 A489V probably benign Het
Pcdhb13 A T 18: 37,443,421 D284V possibly damaging Het
Pde6c T C 19: 38,140,229 S214P possibly damaging Het
Pofut1 C T 2: 153,259,616 H192Y probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Prc1 G A 7: 80,304,796 S165N probably benign Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Ptpru T C 4: 131,785,754 I881V probably benign Het
Radil A G 5: 142,487,115 S847P probably benign Het
Rimklb A G 6: 122,456,412 S317P probably damaging Het
Sdhc A T 1: 171,138,702 L78* probably null Het
Skint6 T A 4: 112,839,313 I1042F possibly damaging Het
Slc1a6 T A 10: 78,801,907 D422E probably damaging Het
Slc29a1 A T 17: 45,589,928 H71Q probably damaging Het
Slfn14 A T 11: 83,276,603 D695E probably damaging Het
Spg11 A T 2: 122,086,805 probably null Het
Srgap2 A G 1: 131,289,616 V986A probably benign Het
Stab1 A T 14: 31,162,519 C172* probably null Het
Tigd4 A G 3: 84,595,267 H497R probably benign Het
Ubn2 G A 6: 38,461,536 G60D probably damaging Het
Uckl1 C T 2: 181,573,073 probably null Het
Vmn2r24 A T 6: 123,816,277 K854N probably benign Het
Vps13d G A 4: 144,975,193 Q3193* probably null Het
Wdr26 G A 1: 181,191,868 L315F probably damaging Het
Zc3h8 C A 2: 128,943,855 E24* probably null Het
Zfp39 A G 11: 58,891,387 V183A probably benign Het
Zfp608 C A 18: 54,988,544 probably benign Het
Other mutations in Mcf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Mcf2l APN 8 13000857 missense probably damaging 0.98
IGL00426:Mcf2l APN 8 12984910 missense probably damaging 1.00
IGL01391:Mcf2l APN 8 13014010 splice site probably null
IGL01795:Mcf2l APN 8 13000749 unclassified probably null
IGL02314:Mcf2l APN 8 13001851 missense probably damaging 0.99
IGL02716:Mcf2l APN 8 12997277 missense probably benign 0.19
IGL02985:Mcf2l APN 8 12963239 missense probably damaging 1.00
IGL03073:Mcf2l APN 8 13000004 missense probably damaging 1.00
IGL03308:Mcf2l APN 8 13009512 missense probably damaging 1.00
IGL03371:Mcf2l APN 8 13001298 missense probably damaging 1.00
P0022:Mcf2l UTSW 8 13018897 nonsense probably null
R0062:Mcf2l UTSW 8 13006766 unclassified probably benign
R0067:Mcf2l UTSW 8 13013060 missense probably benign 0.01
R0110:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0450:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0469:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0510:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0543:Mcf2l UTSW 8 12996728 critical splice donor site probably null
R0591:Mcf2l UTSW 8 13018751 missense probably benign 0.11
R0801:Mcf2l UTSW 8 13014020 intron probably benign
R0962:Mcf2l UTSW 8 13001964 missense probably benign 0.14
R1084:Mcf2l UTSW 8 13002645 missense possibly damaging 0.94
R1794:Mcf2l UTSW 8 12915982 missense probably benign 0.33
R2111:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R2112:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R3785:Mcf2l UTSW 8 12880099 missense probably damaging 0.97
R4777:Mcf2l UTSW 8 13018051 splice site probably null
R4858:Mcf2l UTSW 8 13013972 missense probably damaging 1.00
R4980:Mcf2l UTSW 8 12984883 missense probably damaging 1.00
R5021:Mcf2l UTSW 8 13011808 missense probably damaging 1.00
R5067:Mcf2l UTSW 8 12915959 intron probably benign
R5158:Mcf2l UTSW 8 13009715 missense probably damaging 1.00
R5439:Mcf2l UTSW 8 12926646 missense possibly damaging 0.85
R5569:Mcf2l UTSW 8 13005481 missense probably damaging 1.00
R5655:Mcf2l UTSW 8 13010444 missense probably damaging 0.98
R5668:Mcf2l UTSW 8 13013812 nonsense probably null
R5753:Mcf2l UTSW 8 12999993 missense probably damaging 1.00
R5808:Mcf2l UTSW 8 12993937 start codon destroyed probably null 0.92
R5946:Mcf2l UTSW 8 13013922 missense probably damaging 1.00
R6168:Mcf2l UTSW 8 13001823 missense probably benign 0.05
R6212:Mcf2l UTSW 8 13017431 missense probably damaging 1.00
R6270:Mcf2l UTSW 8 13018701 missense probably damaging 0.99
R6383:Mcf2l UTSW 8 12879912 start gained probably benign
R6850:Mcf2l UTSW 8 13009476 missense possibly damaging 0.82
R6908:Mcf2l UTSW 8 13018919 missense probably benign
R7101:Mcf2l UTSW 8 13013579 missense possibly damaging 0.80
R7163:Mcf2l UTSW 8 12915439 missense probably benign 0.00
R7203:Mcf2l UTSW 8 13010456 missense probably benign 0.09
R7414:Mcf2l UTSW 8 13019022 makesense probably null
R7553:Mcf2l UTSW 8 12997268 missense probably benign
R7556:Mcf2l UTSW 8 12973071 missense probably damaging 0.99
X0052:Mcf2l UTSW 8 13018713 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTGCAGTGTGAGCCTTTC -3'
(R):5'- GTCACCACAGGAAGATGGTG -3'

Sequencing Primer
(F):5'- TTCAGACGCTGCTCCTGGAATG -3'
(R):5'- ATGGTGTGGAAGGCAGTG -3'
Posted On2017-10-10