Incidental Mutation 'R6172:Cand2'
ID488239
Institutional Source Beutler Lab
Gene Symbol Cand2
Ensembl Gene ENSMUSG00000030319
Gene Namecullin-associated and neddylation-dissociated 2 (putative)
Synonyms2210404G23Rik, Tp120b
MMRRC Submission 044315-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6172 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115774538-115805557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115791310 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 472 (E472G)
Ref Sequence ENSEMBL: ENSMUSP00000075377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075995]
Predicted Effect probably benign
Transcript: ENSMUST00000075995
AA Change: E472G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075377
Gene: ENSMUSG00000030319
AA Change: E472G

DomainStartEndE-ValueType
low complexity region 325 347 N/A INTRINSIC
low complexity region 536 548 N/A INTRINSIC
low complexity region 553 562 N/A INTRINSIC
low complexity region 665 686 N/A INTRINSIC
low complexity region 736 748 N/A INTRINSIC
Pfam:HEAT 861 890 4.4e-5 PFAM
Pfam:TIP120 1044 1209 6e-64 PFAM
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap42 A T 9: 9,148,245 C108S possibly damaging Het
Bbs2 T C 8: 94,087,411 E193G probably benign Het
Bpifb2 C A 2: 153,890,412 H310Q probably benign Het
Cd81 A G 7: 143,052,954 probably benign Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Clpx C A 9: 65,301,879 S92* probably null Het
Cstf3 T C 2: 104,651,642 V276A probably damaging Het
Ehd4 G A 2: 120,102,256 Q230* probably null Het
Erich3 A G 3: 154,764,341 T4A possibly damaging Het
Erlin2 T G 8: 27,036,095 probably null Het
Exosc1 C A 19: 41,924,003 Q148H probably damaging Het
Fbxw27 A T 9: 109,772,269 V261E probably damaging Het
Flrt2 T A 12: 95,779,531 N214K probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Frk T C 10: 34,591,965 L325P probably damaging Het
Gm21698 T C 5: 25,987,373 I72V probably benign Het
Gm39115 A T 7: 142,135,914 C41S unknown Het
Hectd1 G A 12: 51,769,282 P1336S probably damaging Het
Ighv7-1 T C 12: 113,896,563 S70G probably damaging Het
Itga10 T C 3: 96,647,437 I78T probably benign Het
Itgb4 A G 11: 116,000,411 H1218R probably benign Het
March6 A T 15: 31,482,867 N463K possibly damaging Het
Muc5b A C 7: 141,858,776 T1820P unknown Het
Nfatc4 A G 14: 55,829,533 T510A possibly damaging Het
Nwd2 G T 5: 63,806,906 V1278F probably damaging Het
Olfr668 A C 7: 104,925,296 M156R probably benign Het
Olfr832 A G 9: 18,944,746 T33A probably benign Het
P2rx1 G A 11: 73,010,030 V209M probably damaging Het
Pkn1 T C 8: 83,670,755 K874R possibly damaging Het
Plec C T 15: 76,172,376 V4444I probably damaging Het
Ppp1r37 A T 7: 19,532,404 M479K possibly damaging Het
Prr11 A C 11: 87,103,623 F66V probably benign Het
Rbbp5 A G 1: 132,496,816 D268G possibly damaging Het
Rbbp6 T A 7: 122,998,555 Y734* probably null Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Rhou A G 8: 123,661,164 K212E probably benign Het
Rsph1 G A 17: 31,273,418 T58I probably benign Het
Serpina3m A G 12: 104,389,227 N51S probably damaging Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc6a5 T A 7: 49,948,333 Y648* probably null Het
Stag3 A G 5: 138,299,843 D699G probably benign Het
Terf2ip A T 8: 112,018,017 D322V probably damaging Het
Vmn1r125 A T 7: 21,272,350 M58L probably benign Het
Wdr49 T A 3: 75,298,180 D643V probably damaging Het
Other mutations in Cand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Cand2 APN 6 115785125 missense probably benign
IGL01329:Cand2 APN 6 115782794 missense probably benign 0.43
IGL01777:Cand2 APN 6 115792857 missense probably damaging 0.99
IGL02008:Cand2 APN 6 115803638 missense probably damaging 1.00
IGL02185:Cand2 APN 6 115789510 missense probably benign 0.01
IGL02219:Cand2 APN 6 115803812 missense probably damaging 1.00
IGL02240:Cand2 APN 6 115803662 missense probably damaging 1.00
IGL02329:Cand2 APN 6 115789607 missense probably damaging 1.00
IGL02396:Cand2 APN 6 115791188 splice site probably benign
IGL02893:Cand2 APN 6 115791960 missense probably damaging 1.00
IGL03161:Cand2 APN 6 115792737 missense probably benign 0.45
IGL03170:Cand2 APN 6 115797900 missense probably damaging 1.00
IGL03257:Cand2 APN 6 115799983 missense possibly damaging 0.80
succor UTSW 6 115791192 missense probably damaging 1.00
R0196:Cand2 UTSW 6 115789502 missense probably damaging 1.00
R0390:Cand2 UTSW 6 115774653 missense possibly damaging 0.90
R0534:Cand2 UTSW 6 115787236 missense probably damaging 0.96
R0630:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0631:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0662:Cand2 UTSW 6 115787210 missense probably benign 0.00
R0671:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0708:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0849:Cand2 UTSW 6 115792391 missense probably damaging 1.00
R1992:Cand2 UTSW 6 115785132 missense possibly damaging 0.88
R3428:Cand2 UTSW 6 115789707 missense probably benign
R3773:Cand2 UTSW 6 115785217 missense probably damaging 0.96
R4329:Cand2 UTSW 6 115799988 missense possibly damaging 0.64
R4489:Cand2 UTSW 6 115789466 missense probably damaging 1.00
R4553:Cand2 UTSW 6 115792211 missense probably damaging 1.00
R4577:Cand2 UTSW 6 115791259 missense probably damaging 1.00
R4634:Cand2 UTSW 6 115797987 missense probably damaging 1.00
R4850:Cand2 UTSW 6 115801948 missense probably benign 0.14
R5155:Cand2 UTSW 6 115792258 missense probably benign 0.42
R5190:Cand2 UTSW 6 115789513 missense probably damaging 1.00
R5378:Cand2 UTSW 6 115801951 missense probably benign 0.00
R5407:Cand2 UTSW 6 115785200 missense possibly damaging 0.76
R5698:Cand2 UTSW 6 115791743 missense probably damaging 1.00
R5701:Cand2 UTSW 6 115797932 missense probably damaging 0.99
R6763:Cand2 UTSW 6 115799969 missense probably benign 0.00
R6920:Cand2 UTSW 6 115791289 missense possibly damaging 0.93
R7229:Cand2 UTSW 6 115791192 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGTCTGTGTTGGAACC -3'
(R):5'- AAAGCAGCCTTGTTCTCCC -3'

Sequencing Primer
(F):5'- TGTGTTGGAACCCTCCCTGG -3'
(R):5'- TGTTCTCCCTGTGGCCAAGAG -3'
Posted On2017-10-10