Incidental Mutation 'R6135:Chpt1'
ID488296
Institutional Source Beutler Lab
Gene Symbol Chpt1
Ensembl Gene ENSMUSG00000060002
Gene Namecholine phosphotransferase 1
Synonyms
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88452745-88504073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88482283 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 199 (V199E)
Ref Sequence ENSEMBL: ENSMUSP00000116413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020253] [ENSMUST00000073783] [ENSMUST00000117440] [ENSMUST00000117579] [ENSMUST00000126074] [ENSMUST00000139109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020253
AA Change: V199E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020253
Gene: ENSMUSG00000060002
AA Change: V199E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 183 1e-24 PFAM
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 263 282 N/A INTRINSIC
transmembrane domain 295 317 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073783
SMART Domains Protein: ENSMUSP00000073455
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 184 1.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117440
AA Change: V199E

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112708
Gene: ENSMUSG00000060002
AA Change: V199E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 61 136 8.8e-18 PFAM
transmembrane domain 159 181 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 263 282 N/A INTRINSIC
transmembrane domain 295 317 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117579
SMART Domains Protein: ENSMUSP00000113179
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 186 2.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126074
AA Change: V199E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123429
Gene: ENSMUSG00000060002
AA Change: V199E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 206 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134318
SMART Domains Protein: ENSMUSP00000122428
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139109
AA Change: V199E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116413
Gene: ENSMUSG00000060002
AA Change: V199E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 183 1e-24 PFAM
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 263 282 N/A INTRINSIC
transmembrane domain 295 317 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000143108
AA Change: V164E
SMART Domains Protein: ENSMUSP00000117620
Gene: ENSMUSG00000060002
AA Change: V164E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 27 102 1.9e-18 PFAM
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Chpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0828:Chpt1 UTSW 10 88476415 missense probably damaging 1.00
R1498:Chpt1 UTSW 10 88477104 missense possibly damaging 0.95
R4271:Chpt1 UTSW 10 88481352 unclassified probably benign
R5411:Chpt1 UTSW 10 88477107 missense probably damaging 1.00
R5839:Chpt1 UTSW 10 88503763 missense probably damaging 1.00
R6144:Chpt1 UTSW 10 88453093 utr 3 prime probably benign
R6291:Chpt1 UTSW 10 88475444 nonsense probably null
R6591:Chpt1 UTSW 10 88485900 intron probably benign
R6691:Chpt1 UTSW 10 88485900 intron probably benign
R6988:Chpt1 UTSW 10 88488406 missense probably damaging 1.00
R7117:Chpt1 UTSW 10 88480849 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATTGAGGCAGAGGATATTTAG -3'
(R):5'- CAGTCAGCTGATACAGAATTCAG -3'

Sequencing Primer
(F):5'- AAAATAGGGAGATTTTCTTCTACGC -3'
(R):5'- TCAGCTGATACAGAATTCAGTGAGG -3'
Posted On2017-10-10