Incidental Mutation 'R6135:Fignl1'
ID488298
Institutional Source Beutler Lab
Gene Symbol Fignl1
Ensembl Gene ENSMUSG00000035455
Gene Namefidgetin-like 1
Synonyms
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location11787431-11808962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11802557 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000126340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047689] [ENSMUST00000109664] [ENSMUST00000150714] [ENSMUST00000171080] [ENSMUST00000171938]
Predicted Effect probably benign
Transcript: ENSMUST00000047689
AA Change: D166G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036932
Gene: ENSMUSG00000035455
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
AAA 442 578 2.62e-20 SMART
Pfam:Vps4_C 635 680 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109664
AA Change: D166G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105290
Gene: ENSMUSG00000035455
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
AAA 442 578 2.62e-20 SMART
Pfam:Vps4_C 635 680 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123815
Predicted Effect probably benign
Transcript: ENSMUST00000150714
SMART Domains Protein: ENSMUSP00000119528
Gene: ENSMUSG00000035455

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152345
Predicted Effect probably benign
Transcript: ENSMUST00000171080
AA Change: D166G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127489
Gene: ENSMUSG00000035455
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
AAA 442 578 2.62e-20 SMART
Pfam:Vps4_C 635 680 9.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171938
AA Change: D166G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126340
Gene: ENSMUSG00000035455
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
AAA 442 578 2.62e-20 SMART
Pfam:Vps4_C 635 680 6.5e-9 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family of proteins. The encoded protein is recruited to sites of DNA damage where it plays a role in DNA double-strand break repair via homologous recombination. This protein has also been shown to localize to the centrosome and inhibit ciliogenesis, and may regulate the proliferation and differentiation of osteoblasts. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Fignl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Fignl1 APN 11 11802845 missense possibly damaging 0.56
IGL02634:Fignl1 APN 11 11802756 nonsense probably null
IGL03161:Fignl1 APN 11 11802680 missense probably benign 0.13
R0226:Fignl1 UTSW 11 11801061 missense probably benign 0.14
R2019:Fignl1 UTSW 11 11802054 missense probably damaging 0.99
R4611:Fignl1 UTSW 11 11801268 missense probably benign
R4744:Fignl1 UTSW 11 11801585 missense probably damaging 0.98
R5182:Fignl1 UTSW 11 11801717 missense probably damaging 1.00
R5322:Fignl1 UTSW 11 11801571 missense probably damaging 1.00
R5470:Fignl1 UTSW 11 11802640 missense probably benign 0.00
R5551:Fignl1 UTSW 11 11801603 missense probably damaging 1.00
R5765:Fignl1 UTSW 11 11802011 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ATGGTGTCATGTGAAATGCTGC -3'
(R):5'- TGCTTTGGCAGGATCTCGAC -3'

Sequencing Primer
(F):5'- TGCAGTGGCTGACTCACCTAAAG -3'
(R):5'- GATCTCGACAGGCTGACAGTAAC -3'
Posted On2017-10-10