Incidental Mutation 'R6135:Strada'
ID488301
Institutional Source Beutler Lab
Gene Symbol Strada
Ensembl Gene ENSMUSG00000069631
Gene NameSTE20-related kinase adaptor alpha
Synonyms2610019A05Rik, 6030402H20Rik
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106163330-106202168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106173314 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 59 (Y59C)
Ref Sequence ENSEMBL: ENSMUSP00000115555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007444] [ENSMUST00000103072] [ENSMUST00000152008]
Predicted Effect probably damaging
Transcript: ENSMUST00000007444
AA Change: Y96C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007444
Gene: ENSMUSG00000069631
AA Change: Y96C

DomainStartEndE-ValueType
Pfam:Pkinase 69 379 2.4e-37 PFAM
Pfam:Pkinase_Tyr 70 302 2.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103072
AA Change: Y59C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099361
Gene: ENSMUSG00000069631
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Pkinase 32 342 2.2e-35 PFAM
Pfam:Pkinase_Tyr 33 266 2.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122989
Predicted Effect probably damaging
Transcript: ENSMUST00000152008
AA Change: Y59C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115555
Gene: ENSMUSG00000069631
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Pkinase 32 159 7.4e-16 PFAM
Pfam:Pkinase_Tyr 33 159 1.5e-10 PFAM
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Strada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Strada APN 11 106171150 splice site probably benign
IGL00870:Strada APN 11 106171257 missense probably damaging 1.00
IGL01564:Strada APN 11 106173292 missense probably damaging 1.00
IGL02508:Strada APN 11 106168356 missense probably benign 0.03
IGL02816:Strada APN 11 106164425 unclassified probably benign
IGL03008:Strada APN 11 106170957 missense probably damaging 1.00
IGL03107:Strada APN 11 106164037 unclassified probably benign
R0587:Strada UTSW 11 106170964 missense probably damaging 1.00
R1614:Strada UTSW 11 106168319 missense probably damaging 1.00
R1764:Strada UTSW 11 106164184 missense probably damaging 0.96
R1852:Strada UTSW 11 106171221 missense possibly damaging 0.65
R3772:Strada UTSW 11 106164822 missense probably damaging 0.99
R4329:Strada UTSW 11 106187173 utr 5 prime probably benign
R4538:Strada UTSW 11 106167825 missense probably damaging 1.00
R5532:Strada UTSW 11 106171017 missense probably damaging 1.00
R6102:Strada UTSW 11 106168436 missense probably benign 0.01
R6337:Strada UTSW 11 106173317 missense possibly damaging 0.80
R6773:Strada UTSW 11 106164907 missense probably damaging 0.99
R7155:Strada UTSW 11 106171039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTAGTCTCCTGCAGAAACC -3'
(R):5'- AGACTGCTACAGTGATTGTCTGAG -3'

Sequencing Primer
(F):5'- CCCCTAGAAGAATGACCATGTGG -3'
(R):5'- CTAATATGAAAGTTCCAGCAGTGAGC -3'
Posted On2017-10-10