Incidental Mutation 'R6135:Rp1l1'
ID488313
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Nameretinitis pigmentosa 1 homolog like 1
SynonymsDcdc4, Rp1hl1
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6135 (G1)
Quality Score205.009
Status Validated
Chromosome14
Chromosomal Location63992506-64035025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64030096 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1044 (P1044S)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
Predicted Effect probably damaging
Transcript: ENSMUST00000058229
AA Change: P1044S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: P1044S

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224314
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64028720 missense probably benign 0.02
R7053:Rp1l1 UTSW 14 64031509 missense possibly damaging 0.68
R7151:Rp1l1 UTSW 14 64029026 missense possibly damaging 0.73
R7291:Rp1l1 UTSW 14 64032298 missense probably benign 0.10
R7335:Rp1l1 UTSW 14 64031998 missense probably benign 0.00
R7344:Rp1l1 UTSW 14 64029620 missense probably benign 0.00
R7470:Rp1l1 UTSW 14 64028566 missense probably benign
R7570:Rp1l1 UTSW 14 64031574 nonsense probably null
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGGGCTACCAATGAGCAC -3'
(R):5'- CCTGGTACTTAGGGGACTCTTC -3'

Sequencing Primer
(F):5'- GGCTACCAATGAGCACCCAGAG -3'
(R):5'- GTACTTAGGGGACTCTTCAAGCC -3'
Posted On2017-10-10