Incidental Mutation 'R6135:Ifnar1'
ID488318
Institutional Source Beutler Lab
Gene Symbol Ifnar1
Ensembl Gene ENSMUSG00000022967
Gene Nameinterferon (alpha and beta) receptor 1
SynonymsIfar, Ifrc, IFN-alpha/betaR
MMRRC Submission 044282-MU
Accession Numbers

Ncbi RefSeq: NM_010508; VEGA:  OTTMUST00000067225; MGI: 107658;

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91485238-91507441 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 91501620 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023689] [ENSMUST00000023689] [ENSMUST00000117748] [ENSMUST00000117748] [ENSMUST00000123196] [ENSMUST00000123196] [ENSMUST00000232453]
Predicted Effect probably null
Transcript: ENSMUST00000023689
SMART Domains Protein: ENSMUSP00000023689
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023689
SMART Domains Protein: ENSMUSP00000023689
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117748
SMART Domains Protein: ENSMUSP00000112670
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117748
SMART Domains Protein: ENSMUSP00000112670
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123196
SMART Domains Protein: ENSMUSP00000119160
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123196
SMART Domains Protein: ENSMUSP00000119160
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231604
Predicted Effect probably benign
Transcript: ENSMUST00000232453
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased susceptibility to viral infection, elevated levels of myeloid lineage cells in the peripheral blood and bone marrow, and reduced immune response to immunostimulatory DNA. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(5) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Ifnar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ifnar1 APN 16 91489782 missense probably damaging 0.99
IGL02183:Ifnar1 APN 16 91505146 missense possibly damaging 0.94
IGL02828:Ifnar1 APN 16 91505416 critical splice donor site probably null
macro-1 UTSW 16 91499885 missense probably damaging 0.98
shook UTSW 16 91499537 nonsense probably null
sneffels UTSW 16 91501620 critical splice acceptor site probably null
R0124:Ifnar1 UTSW 16 91499537 nonsense probably null
R0502:Ifnar1 UTSW 16 91501751 missense probably damaging 1.00
R0617:Ifnar1 UTSW 16 91501682 missense probably damaging 1.00
R1509:Ifnar1 UTSW 16 91503496 missense probably damaging 1.00
R4111:Ifnar1 UTSW 16 91496158 missense probably damaging 1.00
R4473:Ifnar1 UTSW 16 91495170 missense probably damaging 0.98
R4964:Ifnar1 UTSW 16 91505086 missense probably benign 0.08
R5497:Ifnar1 UTSW 16 91505364 missense probably benign 0.01
R6398:Ifnar1 UTSW 16 91505415 critical splice donor site probably null
R6505:Ifnar1 UTSW 16 91499537 nonsense probably null
R6620:Ifnar1 UTSW 16 91496267 splice site probably null
R7229:Ifnar1 UTSW 16 91499556 missense probably benign 0.00
X0057:Ifnar1 UTSW 16 91495424 missense probably damaging 0.98
X0057:Ifnar1 UTSW 16 91505283 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATCTCAGGGGTGCACTTAC -3'
(R):5'- CCCTGTAGTTCAGAAAGGAAACC -3'

Sequencing Primer
(F):5'- AACAGCAGGTTTTTCACTCTCTG -3'
(R):5'- AGGAAACCTTCTACTATCTGAAGC -3'
Posted On2017-10-10