Incidental Mutation 'R6138:Gk5'
ID488450
Institutional Source Beutler Lab
Gene Symbol Gk5
Ensembl Gene ENSMUSG00000041440
Gene Nameglycerol kinase 5 (putative)
SynonymsC330018K18Rik, G630067D24Rik
MMRRC Submission 044285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6138 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location96119362-96184608 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 96176237 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 424 (Q424*)
Ref Sequence ENSEMBL: ENSMUSP00000112717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085217] [ENSMUST00000122383] [ENSMUST00000129774]
Predicted Effect probably null
Transcript: ENSMUST00000085217
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440
AA Change: Q424*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122383
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440
AA Change: Q424*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129774
SMART Domains Protein: ENSMUSP00000123594
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
SCOP:d1bu6o1 24 56 1e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189249
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted(2) Gene trapped(17)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
6820408C15Rik T C 2: 152,440,870 V215A probably damaging Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Akap9 T C 5: 4,067,924 probably null Het
Ccr6 G A 17: 8,256,382 V140I probably damaging Het
Dlat A T 9: 50,645,117 probably null Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Gm13103 T G 4: 143,851,585 H87Q possibly damaging Het
Insm2 T C 12: 55,600,014 I181T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Kitl G A 10: 100,076,906 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Theg A G 10: 79,584,755 S159P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Gk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gk5 APN 9 96137789 missense probably damaging 0.98
IGL01387:Gk5 APN 9 96177554 critical splice donor site probably null
IGL01771:Gk5 APN 9 96177435 missense probably damaging 0.97
IGL02253:Gk5 APN 9 96137771 missense probably damaging 1.00
IGL02380:Gk5 APN 9 96150480 missense possibly damaging 0.92
IGL02566:Gk5 APN 9 96129046 missense possibly damaging 0.56
IGL03137:Gk5 APN 9 96176292 splice site probably benign
IGL03256:Gk5 APN 9 96129053 missense probably damaging 1.00
IGL03326:Gk5 APN 9 96137839 critical splice donor site probably null
barrener UTSW 9 96129096 critical splice donor site probably null
glimpse UTSW 9 96181770 critical splice acceptor site probably null
homer UTSW 9 96140656 nonsense probably null
sean UTSW 9 96176237 nonsense probably null
stripped UTSW 9 96129053 missense probably damaging 1.00
tangyuan UTSW 9 96150797 critical splice donor site probably null
toku UTSW 9 96140629 frame shift probably null
I1329:Gk5 UTSW 9 96140629 frame shift probably null
R0279:Gk5 UTSW 9 96174804 splice site probably benign
R0284:Gk5 UTSW 9 96181770 critical splice acceptor site probably null
R1134:Gk5 UTSW 9 96133407 missense probably benign 0.00
R1184:Gk5 UTSW 9 96150420 splice site probably benign
R1772:Gk5 UTSW 9 96150797 critical splice donor site probably null
R1781:Gk5 UTSW 9 96133455 missense possibly damaging 0.79
R3691:Gk5 UTSW 9 96129096 critical splice donor site probably null
R4213:Gk5 UTSW 9 96129053 missense probably damaging 1.00
R5015:Gk5 UTSW 9 96177417 critical splice acceptor site probably null
R5166:Gk5 UTSW 9 96174768 missense probably damaging 0.99
R5643:Gk5 UTSW 9 96140656 nonsense probably null
R5857:Gk5 UTSW 9 96119455 nonsense probably null
R5924:Gk5 UTSW 9 96150510 critical splice donor site probably null
R6109:Gk5 UTSW 9 96140610 missense probably benign 0.00
R6725:Gk5 UTSW 9 96155470 missense probably benign 0.01
R6812:Gk5 UTSW 9 96150749 missense probably damaging 0.99
R7065:Gk5 UTSW 9 96179056 missense probably damaging 1.00
R7182:Gk5 UTSW 9 96119526 missense possibly damaging 0.89
R7213:Gk5 UTSW 9 96145712 missense probably damaging 1.00
R7260:Gk5 UTSW 9 96119610 missense probably benign 0.10
U15987:Gk5 UTSW 9 96176237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGAGCATAGACTAGGTGC -3'
(R):5'- GCTAGGCATAAGCTTTGGAAG -3'

Sequencing Primer
(F):5'- AGCATAGACTAGGTGCTGTCCAC -3'
(R):5'- CTAGGCATAAGCTTTGGAAGTCATG -3'
Posted On2017-10-10