Incidental Mutation 'R6138:1700012B07Rik'
List |< first << previous [record 61 of 18188] next >> last >|
ID488458
Institutional Source Beutler Lab
Gene Symbol 1700012B07Rik
Ensembl Gene ENSMUSG00000020617
Gene NameRIKEN cDNA 1700012B07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R6138 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109787651-109828046 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 109794154 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 172 (C172*)
Ref Sequence ENSEMBL: ENSMUSP00000102285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020941] [ENSMUST00000106674] [ENSMUST00000143578]
Predicted Effect probably null
Transcript: ENSMUST00000020941
AA Change: C172*
SMART Domains Protein: ENSMUSP00000020941
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106674
AA Change: C172*
SMART Domains Protein: ENSMUSP00000102285
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143578
SMART Domains Protein: ENSMUSP00000115395
Gene: ENSMUSG00000020617

DomainStartEndE-ValueType
low complexity region 33 38 N/A INTRINSIC
low complexity region 53 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147006
Meta Mutation Damage Score 0.6404 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,440,870 V215A probably damaging Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Akap9 T C 5: 4,067,924 probably null Het
Ccr6 G A 17: 8,256,382 V140I probably damaging Het
Dlat A T 9: 50,645,117 probably null Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Gk5 C T 9: 96,176,237 Q424* probably null Het
Gm13103 T G 4: 143,851,585 H87Q possibly damaging Het
Insm2 T C 12: 55,600,014 I181T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Kitl G A 10: 100,076,906 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Theg A G 10: 79,584,755 S159P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in 1700012B07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:1700012B07Rik APN 11 109794111 missense probably damaging 0.99
IGL03006:1700012B07Rik APN 11 109827845 missense probably damaging 0.98
R0626:1700012B07Rik UTSW 11 109788721 unclassified probably benign
R1566:1700012B07Rik UTSW 11 109788806 missense probably benign 0.01
R1654:1700012B07Rik UTSW 11 109797399 missense probably benign 0.36
R2373:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2405:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2410:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2411:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3707:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3708:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3732:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3745:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3783:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3784:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3785:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3805:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3806:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3922:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3926:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4085:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4089:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4110:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4111:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4112:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4171:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4506:1700012B07Rik UTSW 11 109794261 missense probably damaging 1.00
R4825:1700012B07Rik UTSW 11 109791672 missense probably benign 0.00
R5032:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5033:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5971:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6078:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6079:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6354:1700012B07Rik UTSW 11 109794216 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCGGAGAATAGATGCTTGCC -3'
(R):5'- AGCTGCCTCCTGTAGAGTAC -3'

Sequencing Primer
(F):5'- GCTTGCCAATCTAAGATACTGAG -3'
(R):5'- GTACAGCTTGTCTAACGAAGC -3'
Posted On2017-10-10