Incidental Mutation 'R6139:Myh11'
ID 488510
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Name myosin, heavy polypeptide 11, smooth muscle
Synonyms smMHC, SM1, SM2
MMRRC Submission 044286-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6139 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 14012392-14109227 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14033738 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1059 (E1059G)
Ref Sequence ENSEMBL: ENSMUSP00000156021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090287
AA Change: E1052G

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: E1052G

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230397
AA Change: E1052G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000231567
AA Change: E1059G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1263 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,697,150 (GRCm39) T250A probably damaging Het
Acacb T C 5: 114,350,713 (GRCm39) I1074T probably damaging Het
Acsl6 C A 11: 54,231,368 (GRCm39) P462T probably damaging Het
Aebp1 A G 11: 5,821,842 (GRCm39) D747G probably damaging Het
Antxr2 A C 5: 98,125,565 (GRCm39) probably null Het
Arhgap35 T C 7: 16,297,392 (GRCm39) T558A possibly damaging Het
Asap1 T A 15: 64,038,388 (GRCm39) I223F possibly damaging Het
C2cd5 A C 6: 142,980,784 (GRCm39) D669E probably damaging Het
Casz1 C T 4: 149,036,154 (GRCm39) T1472M probably damaging Het
Catsper4 A G 4: 133,945,177 (GRCm39) L154P probably damaging Het
Cep350 T C 1: 155,829,025 (GRCm39) E293G probably benign Het
Cma1 T A 14: 56,180,157 (GRCm39) probably null Het
Ddx42 C T 11: 106,130,843 (GRCm39) A439V probably damaging Het
Disp2 T A 2: 118,621,143 (GRCm39) L625Q probably damaging Het
Dnah1 T C 14: 31,007,984 (GRCm39) D2141G probably benign Het
Dsp T C 13: 38,376,382 (GRCm39) I1389T probably damaging Het
Fam81a A T 9: 70,010,100 (GRCm39) probably null Het
Fsip2 A G 2: 82,821,388 (GRCm39) D5707G possibly damaging Het
Gcnt4 G A 13: 97,083,360 (GRCm39) V219I probably benign Het
Gk2 A G 5: 97,604,139 (GRCm39) V233A probably benign Het
Grm1 T C 10: 10,622,075 (GRCm39) probably benign Het
Gsap T A 5: 21,486,538 (GRCm39) V649D probably damaging Het
Kif1b G A 4: 149,321,989 (GRCm39) H977Y possibly damaging Het
Ktn1 T A 14: 47,963,672 (GRCm39) probably null Het
Lgals12 T A 19: 7,581,742 (GRCm39) T29S probably benign Het
Me3 G T 7: 89,282,108 (GRCm39) probably benign Het
Mgst3 T G 1: 167,205,874 (GRCm39) K35T possibly damaging Het
Mtmr9 T C 14: 63,767,227 (GRCm39) R354G probably benign Het
Nr4a2 T A 2: 56,998,701 (GRCm39) H408L probably damaging Het
Or56b35 A T 7: 104,963,453 (GRCm39) T81S probably damaging Het
Or5ak23 A T 2: 85,244,690 (GRCm39) F178I probably damaging Het
Pds5b T A 5: 150,724,242 (GRCm39) L1275Q possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pop1 T A 15: 34,529,204 (GRCm39) C745S probably benign Het
Ptpn14 T G 1: 189,583,362 (GRCm39) S736R probably benign Het
Rdh9 A T 10: 127,612,606 (GRCm39) T85S possibly damaging Het
Rnf223 T C 4: 156,217,260 (GRCm39) C212R probably damaging Het
Rnf39 A G 17: 37,254,230 (GRCm39) E84G probably damaging Het
Sfmbt1 T A 14: 30,533,375 (GRCm39) V584D probably damaging Het
Slc12a5 T A 2: 164,834,231 (GRCm39) S728T probably damaging Het
Slc16a12 T A 19: 34,648,295 (GRCm39) probably null Het
Snupn C A 9: 56,890,108 (GRCm39) Q310K possibly damaging Het
St7 T C 6: 17,694,353 (GRCm39) L48P probably damaging Het
Thsd7a T C 6: 12,379,572 (GRCm39) N951D possibly damaging Het
Ttn G A 2: 76,682,413 (GRCm39) R959* probably null Het
Ugt2b36 A T 5: 87,240,030 (GRCm39) D118E probably benign Het
Vmn2r7 G A 3: 64,623,339 (GRCm39) T327I probably damaging Het
Wdr70 T C 15: 8,108,735 (GRCm39) D137G probably benign Het
Wrn A T 8: 33,843,360 (GRCm39) M14K probably damaging Het
Xpot T A 10: 121,447,613 (GRCm39) E283V probably benign Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14,095,586 (GRCm39) missense probably benign 0.00
IGL01398:Myh11 APN 16 14,019,964 (GRCm39) missense probably damaging 0.99
IGL01646:Myh11 APN 16 14,039,639 (GRCm39) missense probably damaging 1.00
IGL02470:Myh11 APN 16 14,035,910 (GRCm39) missense probably damaging 1.00
IGL02680:Myh11 APN 16 14,027,384 (GRCm39) missense probably benign 0.02
IGL02687:Myh11 APN 16 14,030,482 (GRCm39) nonsense probably null
IGL02987:Myh11 APN 16 14,050,396 (GRCm39) missense probably damaging 1.00
IGL03008:Myh11 APN 16 14,022,617 (GRCm39) missense probably benign 0.00
G5030:Myh11 UTSW 16 14,068,443 (GRCm39) missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14,018,930 (GRCm39) missense
R0008:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0085:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0086:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0087:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0096:Myh11 UTSW 16 14,022,231 (GRCm39) missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14,022,231 (GRCm39) missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14,029,124 (GRCm39) missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14,036,744 (GRCm39) missense probably benign 0.32
R0546:Myh11 UTSW 16 14,023,492 (GRCm39) missense probably damaging 1.00
R0658:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0715:Myh11 UTSW 16 14,044,480 (GRCm39) missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14,021,042 (GRCm39) missense probably damaging 1.00
R1014:Myh11 UTSW 16 14,054,274 (GRCm39) missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14,019,991 (GRCm39) missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14,023,795 (GRCm39) nonsense probably null
R1560:Myh11 UTSW 16 14,044,484 (GRCm39) nonsense probably null
R1714:Myh11 UTSW 16 14,054,232 (GRCm39) critical splice donor site probably null
R1742:Myh11 UTSW 16 14,037,908 (GRCm39) missense probably damaging 1.00
R1750:Myh11 UTSW 16 14,033,654 (GRCm39) missense probably damaging 0.98
R1750:Myh11 UTSW 16 14,018,622 (GRCm39) missense probably damaging 1.00
R1753:Myh11 UTSW 16 14,095,734 (GRCm39) missense probably benign
R1760:Myh11 UTSW 16 14,051,559 (GRCm39) splice site probably benign
R1829:Myh11 UTSW 16 14,041,744 (GRCm39) missense probably damaging 1.00
R1876:Myh11 UTSW 16 14,086,967 (GRCm39) splice site probably benign
R2027:Myh11 UTSW 16 14,050,532 (GRCm39) missense probably damaging 1.00
R2122:Myh11 UTSW 16 14,035,868 (GRCm39) missense probably damaging 1.00
R2247:Myh11 UTSW 16 14,095,423 (GRCm39) missense probably damaging 1.00
R2495:Myh11 UTSW 16 14,023,421 (GRCm39) missense probably damaging 1.00
R2863:Myh11 UTSW 16 14,057,290 (GRCm39) missense probably benign 0.02
R3684:Myh11 UTSW 16 14,021,098 (GRCm39) missense probably benign 0.00
R3693:Myh11 UTSW 16 14,035,813 (GRCm39) missense probably benign 0.01
R4080:Myh11 UTSW 16 14,041,923 (GRCm39) missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14,036,747 (GRCm39) missense probably damaging 0.97
R4664:Myh11 UTSW 16 14,044,448 (GRCm39) missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14,087,105 (GRCm39) missense probably damaging 0.99
R4694:Myh11 UTSW 16 14,018,566 (GRCm39) missense probably damaging 1.00
R4805:Myh11 UTSW 16 14,052,329 (GRCm39) missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14,018,947 (GRCm39) splice site probably null
R4905:Myh11 UTSW 16 14,068,387 (GRCm39) missense probably benign 0.13
R4939:Myh11 UTSW 16 14,057,371 (GRCm39) missense probably benign
R4964:Myh11 UTSW 16 14,023,818 (GRCm39) missense probably damaging 1.00
R4966:Myh11 UTSW 16 14,023,818 (GRCm39) missense probably damaging 1.00
R5029:Myh11 UTSW 16 14,023,489 (GRCm39) missense probably damaging 1.00
R5045:Myh11 UTSW 16 14,057,391 (GRCm39) nonsense probably null
R5097:Myh11 UTSW 16 14,023,770 (GRCm39) splice site probably null
R5288:Myh11 UTSW 16 14,025,872 (GRCm39) missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14,025,872 (GRCm39) missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14,062,719 (GRCm39) missense probably damaging 0.96
R5856:Myh11 UTSW 16 14,023,840 (GRCm39) missense probably benign 0.00
R5869:Myh11 UTSW 16 14,048,664 (GRCm39) missense probably damaging 1.00
R6019:Myh11 UTSW 16 14,023,938 (GRCm39) missense probably damaging 1.00
R6024:Myh11 UTSW 16 14,095,567 (GRCm39) missense probably damaging 0.99
R6209:Myh11 UTSW 16 14,026,155 (GRCm39) nonsense probably null
R6373:Myh11 UTSW 16 14,022,994 (GRCm39) missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14,044,480 (GRCm39) missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14,023,417 (GRCm39) missense probably damaging 1.00
R6709:Myh11 UTSW 16 14,041,358 (GRCm39) critical splice donor site probably null
R7069:Myh11 UTSW 16 14,036,803 (GRCm39) missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14,033,690 (GRCm39) missense
R7644:Myh11 UTSW 16 14,039,688 (GRCm39) missense
R7838:Myh11 UTSW 16 14,027,481 (GRCm39) missense
R7905:Myh11 UTSW 16 14,025,545 (GRCm39) nonsense probably null
R8261:Myh11 UTSW 16 14,041,867 (GRCm39) missense
R8272:Myh11 UTSW 16 14,036,718 (GRCm39) missense
R8317:Myh11 UTSW 16 14,025,941 (GRCm39) missense
R8359:Myh11 UTSW 16 14,026,095 (GRCm39) critical splice donor site probably null
R8486:Myh11 UTSW 16 14,022,532 (GRCm39) missense possibly damaging 0.77
R8527:Myh11 UTSW 16 14,048,570 (GRCm39) missense probably damaging 1.00
R8861:Myh11 UTSW 16 14,064,646 (GRCm39) missense
R8886:Myh11 UTSW 16 14,052,278 (GRCm39) missense
R8946:Myh11 UTSW 16 14,048,580 (GRCm39) missense probably benign 0.08
R9151:Myh11 UTSW 16 14,050,439 (GRCm39) missense
R9253:Myh11 UTSW 16 14,074,359 (GRCm39) missense
R9257:Myh11 UTSW 16 14,087,120 (GRCm39) missense
R9273:Myh11 UTSW 16 14,054,283 (GRCm39) missense
R9320:Myh11 UTSW 16 14,029,152 (GRCm39) missense
R9364:Myh11 UTSW 16 14,018,580 (GRCm39) missense
R9365:Myh11 UTSW 16 14,052,297 (GRCm39) missense
R9496:Myh11 UTSW 16 14,048,616 (GRCm39) nonsense probably null
R9499:Myh11 UTSW 16 14,064,673 (GRCm39) missense
R9551:Myh11 UTSW 16 14,064,673 (GRCm39) missense
R9554:Myh11 UTSW 16 14,018,580 (GRCm39) missense
R9631:Myh11 UTSW 16 14,025,441 (GRCm39) missense
R9661:Myh11 UTSW 16 14,041,857 (GRCm39) missense
R9679:Myh11 UTSW 16 14,095,436 (GRCm39) missense
R9780:Myh11 UTSW 16 14,064,613 (GRCm39) missense
R9790:Myh11 UTSW 16 14,025,992 (GRCm39) missense
R9791:Myh11 UTSW 16 14,025,992 (GRCm39) missense
X0018:Myh11 UTSW 16 14,095,497 (GRCm39) missense probably damaging 1.00
X0025:Myh11 UTSW 16 14,027,553 (GRCm39) missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14,052,266 (GRCm39) missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14,087,126 (GRCm39) frame shift probably null
Z1176:Myh11 UTSW 16 14,095,639 (GRCm39) missense
Z1176:Myh11 UTSW 16 14,057,260 (GRCm39) missense probably null
Z1177:Myh11 UTSW 16 14,027,459 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTGACATCCATGCCAAGGG -3'
(R):5'- ACACTGTAGGAGGCACATCC -3'

Sequencing Primer
(F):5'- AGGGCCTCTGGACACACATAG -3'
(R):5'- GGCACATCCTGATAGCATTCC -3'
Posted On 2017-10-10