Mutagenetix > Incidental Mutation

Incidental Mutation 'R6140:Nup214'

488518

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

044287-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31864446-31943204 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31941808 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 72 (T72I)

Ref Sequence

ENSEMBL: ENSMUSP00000142255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012] [ENSMUST00000139629] [ENSMUST00000152791]

AlphaFold

Q80U93

Predicted Effect

silent
Transcript: ENSMUST00000065398

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124455

Predicted Effect

silent
Transcript: ENSMUST00000138012

SMART Domains

Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
low complexity region	54	68	N/A	INTRINSIC
low complexity region	106	137	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
low complexity region	181	210	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC
low complexity region	266	278	N/A	INTRINSIC
low complexity region	294	327	N/A	INTRINSIC
low complexity region	348	368	N/A	INTRINSIC
low complexity region	373	382	N/A	INTRINSIC
low complexity region	394	406	N/A	INTRINSIC
low complexity region	421	430	N/A	INTRINSIC
low complexity region	465	491	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	544	572	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139629

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146138

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149300

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152791
AA Change: T72I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156387

Meta Mutation Damage Score

0.1576

Coding Region Coverage

1x: 99.8%
3x: 99.2%
10x: 96.9%
20x: 91.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004P03Rik	T	C	12: 17,055,923 (GRCm39)		probably benign	Het
Adgra2	A	T	8: 27,605,433 (GRCm39)	R593W	probably damaging	Het
Agfg2	T	C	5: 137,665,347 (GRCm39)	Q136R	probably damaging	Het
Ankrd42	T	C	7: 92,241,036 (GRCm39)		probably null	Het
Baz2b	T	C	2: 59,742,871 (GRCm39)	D1643G	probably damaging	Het
Ccdc171	C	T	4: 83,614,554 (GRCm39)	Q1060*	probably null	Het
Cela1	C	T	15: 100,579,037 (GRCm39)	R207H	probably benign	Het
Cfhr4	A	G	1: 139,660,133 (GRCm39)	V664A	probably damaging	Het
Clic6	A	G	16: 92,336,380 (GRCm39)	R563G	probably damaging	Het
Cspg4	A	T	9: 56,804,508 (GRCm39)	H1773L	probably benign	Het
Ddrgk1	A	G	2: 130,500,534 (GRCm39)	V204A	probably benign	Het
Dhrs7c	A	T	11: 67,705,900 (GRCm39)	T218S	probably damaging	Het
Dlgap4	A	T	2: 156,604,649 (GRCm39)		probably null	Het
Hgd	A	T	16: 37,410,075 (GRCm39)	Y37F	probably benign	Het
Hmcn1	A	C	1: 150,608,597 (GRCm39)	N1528K	probably damaging	Het
Hps3	A	G	3: 20,051,151 (GRCm39)	F843S	probably damaging	Het
Ifih1	A	G	2: 62,431,804 (GRCm39)	F800S	possibly damaging	Het
Igsf21	T	A	4: 139,834,684 (GRCm39)	T63S	probably benign	Het
Il18rap	T	G	1: 40,564,212 (GRCm39)	M110R	probably benign	Het
Kcnk2	G	T	1: 188,942,104 (GRCm39)	H384Q	probably damaging	Het
Lima1	C	T	15: 99,678,939 (GRCm39)	V341M	probably damaging	Het
Lins1	T	C	7: 66,361,672 (GRCm39)	L441P	probably damaging	Het
Lss	T	C	10: 76,386,522 (GRCm39)	Y642H	probably damaging	Het
Mrc2	A	G	11: 105,237,615 (GRCm39)	T1098A	probably benign	Het
Nf1	T	A	11: 79,364,146 (GRCm39)		probably null	Het
Nrdc	G	T	4: 108,906,308 (GRCm39)	A730S	probably damaging	Het
Or6c213	T	G	10: 129,574,523 (GRCm39)	K88Q	possibly damaging	Het
Or8g33	A	G	9: 39,337,543 (GRCm39)	S275P	possibly damaging	Het
Or8k35	A	T	2: 86,424,448 (GRCm39)	C241*	probably null	Het
Oxt	A	G	2: 130,418,191 (GRCm39)	Y21C	probably damaging	Het
Pla2g12b	G	A	10: 59,257,263 (GRCm39)		probably benign	Het
Ralgapb	T	C	2: 158,298,492 (GRCm39)	V907A	probably damaging	Het
Rnls	A	T	19: 33,115,600 (GRCm39)	D157E	probably damaging	Het
Slc7a14	C	A	3: 31,291,697 (GRCm39)	V194L	probably benign	Het
Slc7a7	G	A	14: 54,616,515 (GRCm39)	T189I	probably damaging	Het
Snupn	C	A	9: 56,890,108 (GRCm39)	Q310K	possibly damaging	Het
Ssh1	A	G	5: 114,080,692 (GRCm39)	Y891H	probably benign	Het
Suclg2	T	C	6: 95,546,702 (GRCm39)	D258G	probably damaging	Het
Tpk1	A	T	6: 43,400,635 (GRCm39)	M129K	probably benign	Het
Ubr3	A	G	2: 69,803,673 (GRCm39)	I1088V	probably benign	Het
Vmn1r3	A	G	4: 3,185,031 (GRCm39)	I92T	probably damaging	Het
Vmn2r69	G	A	7: 85,060,657 (GRCm39)	S309F	probably damaging	Het
Wsb1	A	T	11: 79,132,444 (GRCm39)	H325Q	probably damaging	Het
Zfp263	A	G	16: 3,566,081 (GRCm39)	S281G	probably benign	Het
Zfp507	A	G	7: 35,493,613 (GRCm39)	S477P	probably damaging	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	31,923,991 (GRCm39)	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	31,896,733 (GRCm39)	missense	probably benign	0.27
IGL01149:Nup214	APN	2	31,924,712 (GRCm39)	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	31,928,190 (GRCm39)	unclassified	probably benign
IGL01409:Nup214	APN	2	31,916,943 (GRCm39)	splice site	probably null
IGL01530:Nup214	APN	2	31,923,733 (GRCm39)	missense	probably benign
IGL01554:Nup214	APN	2	31,941,084 (GRCm39)	nonsense	probably null
IGL01944:Nup214	APN	2	31,924,971 (GRCm39)	nonsense	probably null
IGL02296:Nup214	APN	2	31,878,200 (GRCm39)	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31,867,872 (GRCm39)	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	31,921,287 (GRCm39)	missense	probably benign
IGL02858:Nup214	APN	2	31,900,384 (GRCm39)	splice site	probably benign
IGL02953:Nup214	APN	2	31,878,241 (GRCm39)	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	31,908,254 (GRCm39)	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31,886,452 (GRCm39)	missense	probably benign	0.27
IGL03225:Nup214	APN	2	31,924,423 (GRCm39)	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	31,900,233 (GRCm39)	missense	probably damaging	0.97
Des_moines	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
ANU74:Nup214	UTSW	2	31,924,978 (GRCm39)	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31,880,379 (GRCm39)	splice site	probably null
R0243:Nup214	UTSW	2	31,888,069 (GRCm39)	splice site	probably benign
R0270:Nup214	UTSW	2	31,924,826 (GRCm39)	missense	probably damaging	0.96
R0358:Nup214	UTSW	2	31,894,312 (GRCm39)	splice site	probably null
R1168:Nup214	UTSW	2	31,915,313 (GRCm39)	missense	probably benign
R1242:Nup214	UTSW	2	31,867,782 (GRCm39)	missense	probably benign	0.00
R1481:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1581:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1610:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31,886,392 (GRCm39)	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2293:Nup214	UTSW	2	31,916,887 (GRCm39)	missense	probably benign
R2924:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31,866,632 (GRCm39)	missense	probably benign	0.00
R3426:Nup214	UTSW	2	31,923,415 (GRCm39)	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	31,924,694 (GRCm39)	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	31,941,112 (GRCm39)	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31,884,696 (GRCm39)	missense	probably benign
R4353:Nup214	UTSW	2	31,867,929 (GRCm39)	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31,887,977 (GRCm39)	missense	probably benign	0.36
R4626:Nup214	UTSW	2	31,923,416 (GRCm39)	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
R4938:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31,881,329 (GRCm39)	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	31,907,158 (GRCm39)	missense	unknown
R5406:Nup214	UTSW	2	31,892,619 (GRCm39)	missense	probably damaging	0.96
R5507:Nup214	UTSW	2	31,878,188 (GRCm39)	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	31,924,385 (GRCm39)	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	31,900,308 (GRCm39)	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31,881,353 (GRCm39)	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31,869,790 (GRCm39)	missense	possibly damaging	0.52
R6243:Nup214	UTSW	2	31,892,944 (GRCm39)	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31,881,384 (GRCm39)	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31,872,683 (GRCm39)	nonsense	probably null
R6970:Nup214	UTSW	2	31,941,810 (GRCm39)	missense	probably damaging	1.00
R7028:Nup214	UTSW	2	31,924,168 (GRCm39)	missense	probably benign	0.22
R7114:Nup214	UTSW	2	31,915,256 (GRCm39)	missense	possibly damaging	0.83
R7120:Nup214	UTSW	2	31,941,054 (GRCm39)	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31,878,245 (GRCm39)	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	31,916,917 (GRCm39)	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	31,923,362 (GRCm39)	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31,884,738 (GRCm39)	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31,886,458 (GRCm39)	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31,880,266 (GRCm39)	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8785:Nup214	UTSW	2	31,924,465 (GRCm39)	missense	probably damaging	0.97
R9257:Nup214	UTSW	2	31,923,347 (GRCm39)	missense	possibly damaging	0.92
R9291:Nup214	UTSW	2	31,867,806 (GRCm39)	missense	probably benign	0.00
R9376:Nup214	UTSW	2	31,924,244 (GRCm39)	missense	probably benign	0.00
R9408:Nup214	UTSW	2	31,937,523 (GRCm39)	missense	probably damaging	1.00
R9613:Nup214	UTSW	2	31,901,035 (GRCm39)	missense	possibly damaging	0.90
R9789:Nup214	UTSW	2	31,907,227 (GRCm39)	missense	possibly damaging	0.46
RF015:Nup214	UTSW	2	31,924,718 (GRCm39)	missense	probably benign	0.00
X0026:Nup214	UTSW	2	31,910,318 (GRCm39)	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	31,932,488 (GRCm39)	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	31,901,235 (GRCm39)	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	31,924,237 (GRCm39)	nonsense	probably null
Z1176:Nup214	UTSW	2	31,900,270 (GRCm39)	missense	possibly damaging	0.66
Z1177:Nup214	UTSW	2	31,887,971 (GRCm39)	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGCAGTGCACAGACCGTTAC -3'
(R):5'- AGGCCAATCATCTCTTACTCAG -3'

Sequencing Primer
(F):5'- TGCACAGACCGTTACCTGCAG -3'
(R):5'- TACTCAGCCTCCCGCAG -3'

Posted On

2017-10-10