Incidental Mutation 'R6140:Cela1'
ID488551
Institutional Source Beutler Lab
Gene Symbol Cela1
Ensembl Gene ENSMUSG00000023031
Gene Namechymotrypsin-like elastase family, member 1
Synonyms1810062B19Rik, Ela1, Ela-1, 1810009A17Rik, PC-TsF
MMRRC Submission 044287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6140 (G1)
Quality Score166.009
Status Validated
Chromosome15
Chromosomal Location100674421-100687921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100681156 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 207 (R207H)
Ref Sequence ENSEMBL: ENSMUSP00000023775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023775] [ENSMUST00000229869] [ENSMUST00000230572] [ENSMUST00000230740] [ENSMUST00000230744]
Predicted Effect probably benign
Transcript: ENSMUST00000023775
AA Change: R207H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000023775
Gene: ENSMUSG00000023031
AA Change: R207H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 26 259 1.24e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229235
Predicted Effect probably benign
Transcript: ENSMUST00000229869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229888
Predicted Effect unknown
Transcript: ENSMUST00000230312
AA Change: R144H
Predicted Effect probably benign
Transcript: ENSMUST00000230572
AA Change: R10H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230642
Predicted Effect probably benign
Transcript: ENSMUST00000230740
AA Change: R10H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000230744
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.9%
  • 20x: 91.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,005,922 probably benign Het
Adgra2 A T 8: 27,115,405 R593W probably damaging Het
Agfg2 T C 5: 137,667,085 Q136R probably damaging Het
Ankrd42 T C 7: 92,591,828 probably null Het
Baz2b T C 2: 59,912,527 D1643G probably damaging Het
Ccdc171 C T 4: 83,696,317 Q1060* probably null Het
Clic6 A G 16: 92,539,492 R563G probably damaging Het
Cspg4 A T 9: 56,897,224 H1773L probably benign Het
Ddrgk1 A G 2: 130,658,614 V204A probably benign Het
Dhrs7c A T 11: 67,815,074 T218S probably damaging Het
Dlgap4 A T 2: 156,762,729 probably null Het
Gm4788 A G 1: 139,732,395 V664A probably damaging Het
Hgd A T 16: 37,589,713 Y37F probably benign Het
Hmcn1 A C 1: 150,732,846 N1528K probably damaging Het
Hps3 A G 3: 19,996,987 F843S probably damaging Het
Ifih1 A G 2: 62,601,460 F800S possibly damaging Het
Igsf21 T A 4: 140,107,373 T63S probably benign Het
Il18rap T G 1: 40,525,052 M110R probably benign Het
Kcnk2 G T 1: 189,209,907 H384Q probably damaging Het
Lima1 C T 15: 99,781,058 V341M probably damaging Het
Lins1 T C 7: 66,711,924 L441P probably damaging Het
Lss T C 10: 76,550,688 Y642H probably damaging Het
Mrc2 A G 11: 105,346,789 T1098A probably benign Het
Nf1 T A 11: 79,473,320 probably null Het
Nrd1 G T 4: 109,049,111 A730S probably damaging Het
Nup214 C T 2: 32,051,796 T72I possibly damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr806 T G 10: 129,738,654 K88Q possibly damaging Het
Olfr952 A G 9: 39,426,247 S275P possibly damaging Het
Oxt A G 2: 130,576,271 Y21C probably damaging Het
Pla2g12b G A 10: 59,421,441 probably benign Het
Ralgapb T C 2: 158,456,572 V907A probably damaging Het
Rnls A T 19: 33,138,200 D157E probably damaging Het
Slc7a14 C A 3: 31,237,548 V194L probably benign Het
Slc7a7 G A 14: 54,379,058 T189I probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Ssh1 A G 5: 113,942,631 Y891H probably benign Het
Suclg2 T C 6: 95,569,721 D258G probably damaging Het
Tpk1 A T 6: 43,423,701 M129K probably benign Het
Ubr3 A G 2: 69,973,329 I1088V probably benign Het
Vmn1r3 A G 4: 3,185,031 I92T probably damaging Het
Vmn2r69 G A 7: 85,411,449 S309F probably damaging Het
Wsb1 A T 11: 79,241,618 H325Q probably damaging Het
Zfp263 A G 16: 3,748,217 S281G probably benign Het
Zfp507 A G 7: 35,794,188 S477P probably damaging Het
Other mutations in Cela1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1845:Cela1 UTSW 15 100685167 missense probably benign 0.43
R2060:Cela1 UTSW 15 100675322 critical splice donor site probably null
R2358:Cela1 UTSW 15 100681228 missense probably benign
R3968:Cela1 UTSW 15 100684653 missense probably damaging 1.00
R4236:Cela1 UTSW 15 100682913 missense probably damaging 1.00
R5491:Cela1 UTSW 15 100682980 missense probably damaging 1.00
R6378:Cela1 UTSW 15 100687190 missense probably benign 0.00
R7057:Cela1 UTSW 15 100682893 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGAACTCTCATGTCCCCTC -3'
(R):5'- CCATGACCTGCAACAAGCTG -3'

Sequencing Primer
(F):5'- CCCACTTGGAGGTTCTGTGATAGAG -3'
(R):5'- CCACATTCAGGTCAGGAGATCTTG -3'
Posted On2017-10-10