Incidental Mutation 'R6142:Prrc2c'
ID488607
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Nameproline-rich coiled-coil 2C
Synonyms9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location162670725-162740556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162710387 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 558 (E558G)
Ref Sequence ENSEMBL: ENSMUSP00000138609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183011]
Predicted Effect unknown
Transcript: ENSMUST00000028016
AA Change: E563G
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225
AA Change: E563G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182149
AA Change: E565G
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225
AA Change: E565G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182448
Predicted Effect unknown
Transcript: ENSMUST00000182593
AA Change: E563G
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225
AA Change: E563G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182660
AA Change: E565G
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225
AA Change: E565G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183011
AA Change: E558G
SMART Domains Protein: ENSMUSP00000138609
Gene: ENSMUSG00000040225
AA Change: E558G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 160 3.2e-64 PFAM
low complexity region 400 407 N/A INTRINSIC
coiled coil region 443 560 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162720613 splice site probably null
IGL00577:Prrc2c APN 1 162698116 missense unknown
IGL00580:Prrc2c APN 1 162698116 missense unknown
IGL01295:Prrc2c APN 1 162682492 missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162710786 missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162706462 unclassified probably benign
IGL01745:Prrc2c APN 1 162724728 missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162704499 missense probably benign 0.23
IGL01905:Prrc2c APN 1 162705329 unclassified probably benign
IGL02304:Prrc2c APN 1 162684136 missense probably benign 0.05
IGL02389:Prrc2c APN 1 162692870 missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162723137 missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162705612 unclassified probably benign
IGL02686:Prrc2c APN 1 162707947 unclassified probably benign
IGL02795:Prrc2c APN 1 162714299 missense probably benign
IGL02894:Prrc2c APN 1 162678057 missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162706535 unclassified probably benign
IGL02981:Prrc2c APN 1 162705179 unclassified probably benign
IGL03070:Prrc2c APN 1 162677409 missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162702359 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0135:Prrc2c UTSW 1 162715483 splice site probably benign
R0279:Prrc2c UTSW 1 162715464 missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162697811 missense unknown
R0436:Prrc2c UTSW 1 162705314 unclassified probably benign
R0605:Prrc2c UTSW 1 162682426 missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162708852 critical splice donor site probably null
R0981:Prrc2c UTSW 1 162705981 unclassified probably benign
R1693:Prrc2c UTSW 1 162718713 missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162677376 missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162704982 unclassified probably benign
R1794:Prrc2c UTSW 1 162705959 unclassified probably benign
R1998:Prrc2c UTSW 1 162704918 unclassified probably benign
R2040:Prrc2c UTSW 1 162697557 missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162710334 unclassified probably benign
R2246:Prrc2c UTSW 1 162707791 unclassified probably benign
R2830:Prrc2c UTSW 1 162708916 unclassified probably benign
R2926:Prrc2c UTSW 1 162706127 unclassified probably benign
R3703:Prrc2c UTSW 1 162710691 missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162698185 missense unknown
R3760:Prrc2c UTSW 1 162692851 missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162709669 unclassified probably benign
R3959:Prrc2c UTSW 1 162708892 unclassified probably benign
R4255:Prrc2c UTSW 1 162706326 unclassified probably benign
R4276:Prrc2c UTSW 1 162673591 missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162709061 unclassified probably benign
R4593:Prrc2c UTSW 1 162697532 missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162680895 missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162705179 unclassified probably benign
R4688:Prrc2c UTSW 1 162697687 missense unknown
R4753:Prrc2c UTSW 1 162691230 missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162710481 missense unknown
R4981:Prrc2c UTSW 1 162692547 missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162705310 unclassified probably benign
R5119:Prrc2c UTSW 1 162705440 unclassified probably benign
R5127:Prrc2c UTSW 1 162697846 missense unknown
R5291:Prrc2c UTSW 1 162705582 unclassified probably benign
R5474:Prrc2c UTSW 1 162709644 unclassified probably benign
R5543:Prrc2c UTSW 1 162673511 missense probably damaging 0.99
R5579:Prrc2c UTSW 1 162680758 critical splice donor site probably null
R5594:Prrc2c UTSW 1 162699031 missense unknown
R5620:Prrc2c UTSW 1 162673529 missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162674156 splice site probably null
R6199:Prrc2c UTSW 1 162682516 missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162714314 missense probably benign
R6504:Prrc2c UTSW 1 162697795 missense unknown
R6671:Prrc2c UTSW 1 162697585 missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162709101 unclassified probably benign
R6799:Prrc2c UTSW 1 162709061 unclassified probably benign
R6801:Prrc2c UTSW 1 162709061 unclassified probably benign
R6850:Prrc2c UTSW 1 162709061 unclassified probably benign
R6851:Prrc2c UTSW 1 162709061 unclassified probably benign
R6856:Prrc2c UTSW 1 162682371 missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162709061 unclassified probably benign
R6882:Prrc2c UTSW 1 162709061 unclassified probably benign
R6884:Prrc2c UTSW 1 162709061 unclassified probably benign
R6897:Prrc2c UTSW 1 162705506 unclassified probably benign
R6934:Prrc2c UTSW 1 162720505 missense probably benign 0.10
R6976:Prrc2c UTSW 1 162692844 missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162681281 missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162673517 missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162679974 missense possibly damaging 0.59
X0020:Prrc2c UTSW 1 162707847 unclassified probably benign
X0039:Prrc2c UTSW 1 162704793 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGTATACATGCAAGGCCCTG -3'
(R):5'- AAAGCAGCCATCTCCAGAGG -3'

Sequencing Primer
(F):5'- GCCTTCACCTCTCCACCATTAAC -3'
(R):5'- GCCATCTCCAGAGGAACTTAGAG -3'
Posted On2017-10-10