Incidental Mutation 'R6142:Spg20'
ID488613
Institutional Source Beutler Lab
Gene Symbol Spg20
Ensembl Gene ENSMUSG00000036580
Gene Namespastic paraplegia 20, spartin (Troyer syndrome) homolog (human)
SynonymsTAHCCP1
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location55112108-55137322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55117248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 88 (V88G)
Ref Sequence ENSEMBL: ENSMUSP00000121683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118] [ENSMUST00000146109] [ENSMUST00000149767]
Predicted Effect probably damaging
Transcript: ENSMUST00000044116
AA Change: V88G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580
AA Change: V88G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107971
AA Change: V88G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580
AA Change: V88G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117341
AA Change: V88G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580
AA Change: V88G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118118
AA Change: V88G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580
AA Change: V88G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146109
AA Change: V88G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121683
Gene: ENSMUSG00000036580
AA Change: V88G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149767
AA Change: V88G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119719
Gene: ENSMUSG00000036580
AA Change: V88G

DomainStartEndE-ValueType
MIT 16 92 6.83e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200658
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Spg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spg20 APN 3 55121756 missense probably damaging 1.00
IGL01539:Spg20 APN 3 55117302 missense possibly damaging 0.95
IGL01982:Spg20 APN 3 55128490 splice site probably null
IGL02345:Spg20 APN 3 55117726 unclassified probably null
IGL03217:Spg20 APN 3 55128491 splice site probably benign
IGL03344:Spg20 APN 3 55121685 missense probably benign 0.03
R0145:Spg20 UTSW 3 55127671 nonsense probably null
R0522:Spg20 UTSW 3 55128365 missense probably damaging 1.00
R1506:Spg20 UTSW 3 55117571 missense probably damaging 0.99
R2043:Spg20 UTSW 3 55127548 missense probably damaging 1.00
R2183:Spg20 UTSW 3 55117133 missense probably benign 0.43
R4022:Spg20 UTSW 3 55117736 missense probably damaging 1.00
R5154:Spg20 UTSW 3 55117329 missense probably damaging 1.00
R5869:Spg20 UTSW 3 55135510 missense probably benign 0.00
R5987:Spg20 UTSW 3 55126541 missense probably benign 0.00
R6185:Spg20 UTSW 3 55117219 missense probably damaging 1.00
R6652:Spg20 UTSW 3 55124827 missense probably benign 0.00
R6791:Spg20 UTSW 3 55127561 missense probably damaging 1.00
R7131:Spg20 UTSW 3 55121799 critical splice donor site probably null
X0018:Spg20 UTSW 3 55135499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAACACGGACGAGTTAG -3'
(R):5'- AACAGTGTAGTGGCCCTCAG -3'

Sequencing Primer
(F):5'- CACGGACGAGTTAGGGCAG -3'
(R):5'- AGAAGGCGCACCACTTG -3'
Posted On2017-10-10