Incidental Mutation 'R6142:Cnot6l'
ID488619
Institutional Source Beutler Lab
Gene Symbol Cnot6l
Ensembl Gene ENSMUSG00000034724
Gene NameCCR4-NOT transcription complex, subunit 6-like
Synonyms
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location96070333-96164171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96082978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 377 (V377I)
Ref Sequence ENSEMBL: ENSMUSP00000113821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036646] [ENSMUST00000113005] [ENSMUST00000122003] [ENSMUST00000155901]
Predicted Effect probably benign
Transcript: ENSMUST00000036646
Predicted Effect probably benign
Transcript: ENSMUST00000113005
AA Change: V382I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108629
Gene: ENSMUSG00000034724
AA Change: V382I

DomainStartEndE-ValueType
LRR 55 77 4.34e-1 SMART
LRR 78 100 1.01e-1 SMART
LRR 101 124 7.55e-1 SMART
Pfam:Exo_endo_phos 192 529 7.3e-22 PFAM
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122003
AA Change: V377I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113821
Gene: ENSMUSG00000034724
AA Change: V377I

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 433 1.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152490
Predicted Effect probably benign
Transcript: ENSMUST00000155901
AA Change: V377I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119415
Gene: ENSMUSG00000034724
AA Change: V377I

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 524 2.2e-23 PFAM
low complexity region 527 540 N/A INTRINSIC
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Cnot6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Cnot6l APN 5 96086246 missense probably damaging 1.00
IGL02102:Cnot6l APN 5 96091659 missense probably damaging 0.98
R0443:Cnot6l UTSW 5 96091745 splice site probably benign
R0448:Cnot6l UTSW 5 96080046 missense probably benign 0.00
R1436:Cnot6l UTSW 5 96134112 missense probably damaging 1.00
R2198:Cnot6l UTSW 5 96079941 missense possibly damaging 0.79
R4240:Cnot6l UTSW 5 96077362 missense probably benign
R4506:Cnot6l UTSW 5 96086174 missense possibly damaging 0.93
R4624:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4627:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4629:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4868:Cnot6l UTSW 5 96083023 missense probably damaging 1.00
R4936:Cnot6l UTSW 5 96079937 missense probably damaging 1.00
R5597:Cnot6l UTSW 5 96131119 missense probably damaging 1.00
R5781:Cnot6l UTSW 5 96086165 missense probably benign 0.31
R6166:Cnot6l UTSW 5 96079940 missense possibly damaging 0.79
R6189:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R6382:Cnot6l UTSW 5 96128999 missense probably damaging 0.99
R6515:Cnot6l UTSW 5 96161678 intron probably benign
R6773:Cnot6l UTSW 5 96094299 missense probably damaging 1.00
R7326:Cnot6l UTSW 5 96077299 missense probably benign 0.00
R7466:Cnot6l UTSW 5 96131128 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGAGCTGGATGGTCTTCC -3'
(R):5'- CCCTTTAGCTTCTCAGATAAGTTTG -3'

Sequencing Primer
(F):5'- TCCAATCAAGACTAAATGTGAAACTG -3'
(R):5'- ATGAAGTAGCTATGGATCTTTTTCAG -3'
Posted On2017-10-10