Incidental Mutation 'R6142:Vmn2r12'
ID488621
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Namevomeronasal 2, receptor 12
SynonymsGm6769
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109085849-109097864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109092897 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 117 (I117L)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
Predicted Effect probably benign
Transcript: ENSMUST00000095922
AA Change: I117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: I117L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109097675 missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109086259 missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109091850 missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109093027 nonsense probably null
IGL01762:Vmn2r12 APN 5 109086564 missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109092159 missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109086477 missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109085992 missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109090485 missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109092070 missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109092899 missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109091889 nonsense probably null
R0529:Vmn2r12 UTSW 5 109092848 missense probably benign
R0715:Vmn2r12 UTSW 5 109090507 missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109086415 missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109087850 critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109091897 missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109086586 missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109092974 missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109092830 missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109092044 missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109091728 missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109092076 missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109091474 missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109090504 missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109091546 missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109086435 missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109086513 missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109092986 missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109091678 missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109091506 missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109090395 missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109091818 missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109086617 nonsense probably null
R5639:Vmn2r12 UTSW 5 109092800 missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109091804 missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109085870 nonsense probably null
R6162:Vmn2r12 UTSW 5 109086564 missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109086000 missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109092905 missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109097789 missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109086247 missense possibly damaging 0.74
R7341:Vmn2r12 UTSW 5 109091945 missense possibly damaging 0.95
R7383:Vmn2r12 UTSW 5 109092818 missense probably benign 0.19
Z1088:Vmn2r12 UTSW 5 109092780 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCACTCATAAATGCATATTCTCC -3'
(R):5'- CCAAACTTTTCAAATCATAGTGCCC -3'

Sequencing Primer
(F):5'- CACCACCTGTAATGGGATCTGATG -3'
(R):5'- ACATCTCCCTTAATCATAATTATGCC -3'
Posted On2017-10-10