Incidental Mutation 'R6142:Zfp773'
ID488625
Institutional Source Beutler Lab
Gene Symbol Zfp773
Ensembl Gene ENSMUSG00000063535
Gene Namezinc finger protein 773
Synonyms2810409K11Rik
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location7127073-7136755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7132482 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 372 (T372A)
Ref Sequence ENSEMBL: ENSMUSP00000032622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032622] [ENSMUST00000211240]
Predicted Effect probably benign
Transcript: ENSMUST00000032622
AA Change: T372A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032622
Gene: ENSMUSG00000063535
AA Change: T372A

DomainStartEndE-ValueType
KRAB 75 134 6.82e-8 SMART
ZnF_C2H2 241 263 1.31e0 SMART
ZnF_C2H2 269 291 1.5e-4 SMART
ZnF_C2H2 297 319 4.17e-3 SMART
ZnF_C2H2 325 347 2.05e-2 SMART
ZnF_C2H2 353 375 2.24e-3 SMART
ZnF_C2H2 381 403 8.81e-2 SMART
ZnF_C2H2 409 431 7.26e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211240
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Other mutations in Zfp773
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Zfp773 APN 7 7132684 missense probably damaging 1.00
IGL00780:Zfp773 APN 7 7133114 missense probably benign 0.00
IGL01348:Zfp773 APN 7 7135315 missense possibly damaging 0.93
IGL02224:Zfp773 APN 7 7132976 missense probably benign 0.00
IGL02447:Zfp773 APN 7 7136656 utr 5 prime probably benign
IGL02869:Zfp773 APN 7 7134233 missense probably benign 0.22
R0505:Zfp773 UTSW 7 7133024 missense probably benign 0.03
R0585:Zfp773 UTSW 7 7132575 missense probably benign 0.21
R0804:Zfp773 UTSW 7 7133093 intron probably benign
R0846:Zfp773 UTSW 7 7132692 missense probably damaging 1.00
R1179:Zfp773 UTSW 7 7133093 intron probably benign
R2847:Zfp773 UTSW 7 7133093 intron probably benign
R3841:Zfp773 UTSW 7 7132391 missense possibly damaging 0.92
R4116:Zfp773 UTSW 7 7133093 intron probably benign
R4638:Zfp773 UTSW 7 7135336 missense probably damaging 1.00
R5126:Zfp773 UTSW 7 7136624 missense unknown
R7072:Zfp773 UTSW 7 7132875 missense probably benign 0.15
R7232:Zfp773 UTSW 7 7132985 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTCCAGTCCTGTAGCAAAACAC -3'
(R):5'- TGTGAGAAGTCCTTCATCCAAAAG -3'

Sequencing Primer
(F):5'- CTGCAGTGTGAAATCTCTGATGC -3'
(R):5'- CCTTGTTGGGCATCAAAGAC -3'
Posted On2017-10-10