Incidental Mutation 'R6142:Hipk4'
ID488626
Institutional Source Beutler Lab
Gene Symbol Hipk4
Ensembl Gene ENSMUSG00000040424
Gene Namehomeodomain interacting protein kinase 4
SynonymsLOC233020
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6142 (G1)
Quality Score161.009
Status Validated
Chromosome7
Chromosomal Location27523267-27531175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27529165 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 347 (V347M)
Ref Sequence ENSEMBL: ENSMUSP00000103990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000108353] [ENSMUST00000117095] [ENSMUST00000117611]
Predicted Effect probably damaging
Transcript: ENSMUST00000037134
AA Change: V143M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424
AA Change: V143M

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108353
AA Change: V347M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424
AA Change: V347M

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117095
SMART Domains Protein: ENSMUSP00000113820
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
Pfam:PLDc_3 224 401 1.6e-43 PFAM
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117611
SMART Domains Protein: ENSMUSP00000112942
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
low complexity region 285 297 N/A INTRINSIC
PLDc 409 435 1.19e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155287
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeodomain interacting protein kinase (HIPK) family of proteins. While other members of this family are found throughout vertebrates, this member is present only in mammals. Compared to other members of this family, the encoded protein lacks a nuclear localization signal and a C-terminal autoinhibitory domain. The encoded protein exhibits kinase activity and may phosphorylate the tumor suppressor protein p53. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Hipk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Hipk4 APN 7 27528543 nonsense probably null
IGL02712:Hipk4 APN 7 27528635 missense probably damaging 1.00
R2018:Hipk4 UTSW 7 27529004 missense probably damaging 1.00
R3813:Hipk4 UTSW 7 27523947 missense probably damaging 1.00
R4796:Hipk4 UTSW 7 27528570 missense probably benign 0.00
R5121:Hipk4 UTSW 7 27529492 missense probably benign 0.02
R5738:Hipk4 UTSW 7 27528416 missense probably damaging 1.00
R5776:Hipk4 UTSW 7 27528980 missense probably damaging 1.00
R6578:Hipk4 UTSW 7 27528387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTTGGACCAGATTGAGACAG -3'
(R):5'- CTTGTCCTCCCTGAAGAAGG -3'

Sequencing Primer
(F):5'- CTTGGACCAGATTGAGACAGTGAATG -3'
(R):5'- TGAAGAAGGACCCACTGCCTG -3'
Posted On2017-10-10