Incidental Mutation 'R6142:Sbf2'
ID488627
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene NameSET binding factor 2
SynonymsmMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
MMRRC Submission 044289-MU
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110308013-110614922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110348975 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1177 (S1177P)
Ref Sequence ENSEMBL: ENSMUSP00000126217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
Predicted Effect probably damaging
Transcript: ENSMUST00000033058
AA Change: S1223P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: S1223P

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000164525
AA Change: S160P
SMART Domains Protein: ENSMUSP00000128340
Gene: ENSMUSG00000038371
AA Change: S160P

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:Myotub-related 28 217 1.5e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164599
AA Change: S108P
SMART Domains Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371
AA Change: S108P

DomainStartEndE-ValueType
Pfam:Myotub-related 1 339 1.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164759
AA Change: S1223P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: S1223P

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166020
AA Change: S1177P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: S1177P

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169740
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0121:Sbf2 UTSW 7 110489219 critical splice donor site probably null
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110428346 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R6986:Sbf2 UTSW 7 110330615 missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAACAGACCCTGCCTTTTC -3'
(R):5'- TAGTCCTGCCCTGTGCTTAG -3'

Sequencing Primer
(F):5'- ACAGACCCTGCCTTTTCAGAGG -3'
(R):5'- CCCTGTGCTTAGAAGGCTAGTC -3'
Posted On2017-10-10