Incidental Mutation 'R6142:Hyal1'
ID488630
Institutional Source Beutler Lab
Gene Symbol Hyal1
Ensembl Gene ENSMUSG00000010051
Gene Namehyaluronoglucosaminidase 1
SynonymsHyal-1
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107576927-107581710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107579374 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 420 (R420H)
Ref Sequence ENSEMBL: ENSMUSP00000120599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010195] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000112387] [ENSMUST00000122985] [ENSMUST00000123005] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000144392] [ENSMUST00000148440] [ENSMUST00000149638]
Predicted Effect probably benign
Transcript: ENSMUST00000010195
AA Change: R450H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051
AA Change: R450H

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093785
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112387
AA Change: R450H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051
AA Change: R450H

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122985
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123005
AA Change: R170H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051
AA Change: R170H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127380
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130053
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139274
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139581
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144392
AA Change: R420H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051
AA Change: R420H

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149638
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184695
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a progressive osteoarthritis associated with bony outgrowths, early loss of articular cartilage proteoglycans and accumulation of hyaluronan (HA) in the cartilage of knee joints, but show no signs of non-skeletal tissue GAG accumulation or increased serum HA levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Hyal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Hyal1 APN 9 107579139 missense probably damaging 1.00
IGL02265:Hyal1 APN 9 107577908 missense probably benign 0.03
R0043:Hyal1 UTSW 9 107579320 missense probably benign 0.15
R0727:Hyal1 UTSW 9 107578402 missense possibly damaging 0.71
R1497:Hyal1 UTSW 9 107577995 unclassified probably null
R1499:Hyal1 UTSW 9 107577892 missense probably damaging 1.00
R3903:Hyal1 UTSW 9 107578972 critical splice donor site probably null
R4662:Hyal1 UTSW 9 107579221 missense probably damaging 1.00
R4977:Hyal1 UTSW 9 107578954 missense probably benign 0.19
R5122:Hyal1 UTSW 9 107578069 missense probably benign 0.00
R5781:Hyal1 UTSW 9 107577667 missense probably damaging 1.00
R6651:Hyal1 UTSW 9 107579371 missense probably damaging 1.00
R6945:Hyal1 UTSW 9 107579170 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCAGCTCTTTTGTGCAGC -3'
(R):5'- TGACTATTCCCGTGACTGTGC -3'

Sequencing Primer
(F):5'- AGCTCTTTTGTGCAGCGAAGC -3'
(R):5'- CCCGTGACTGTGCCTATGTG -3'
Posted On2017-10-10