Incidental Mutation 'R6142:Arfgap3'
ID488637
Institutional Source Beutler Lab
Gene Symbol Arfgap3
Ensembl Gene ENSMUSG00000054277
Gene NameADP-ribosylation factor GTPase activating protein 3
Synonyms1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6142 (G1)
Quality Score145.008
Status Validated
Chromosome15
Chromosomal Location83299739-83350247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83350127 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 8 (D8G)
Ref Sequence ENSEMBL: ENSMUSP00000064893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124]
Predicted Effect probably damaging
Transcript: ENSMUST00000067215
AA Change: D8G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: D8G

DomainStartEndE-ValueType
ArfGap 10 126 7.18e-44 SMART
Blast:ArfGap 160 200 2e-6 BLAST
low complexity region 220 237 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
low complexity region 459 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178628
Predicted Effect probably damaging
Transcript: ENSMUST00000226124
AA Change: D8G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.552 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Arfgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Arfgap3 APN 15 83322589 missense probably benign 0.04
IGL01306:Arfgap3 APN 15 83313509 missense possibly damaging 0.78
IGL01960:Arfgap3 APN 15 83313557 missense probably benign 0.04
IGL03029:Arfgap3 APN 15 83322650 missense probably damaging 1.00
IGL03036:Arfgap3 APN 15 83306926 missense possibly damaging 0.91
IGL03328:Arfgap3 APN 15 83343081 missense probably damaging 1.00
ANU23:Arfgap3 UTSW 15 83313509 missense possibly damaging 0.78
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0125:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R0243:Arfgap3 UTSW 15 83330513 splice site probably benign
R0551:Arfgap3 UTSW 15 83343137 missense probably damaging 1.00
R0557:Arfgap3 UTSW 15 83303185 missense probably damaging 1.00
R0638:Arfgap3 UTSW 15 83308188 splice site probably null
R1115:Arfgap3 UTSW 15 83330540 missense probably benign 0.00
R1459:Arfgap3 UTSW 15 83306937 missense probably benign 0.15
R1576:Arfgap3 UTSW 15 83313563 missense possibly damaging 0.94
R1776:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R1826:Arfgap3 UTSW 15 83303102 critical splice donor site probably null
R2057:Arfgap3 UTSW 15 83310300 missense probably benign
R2084:Arfgap3 UTSW 15 83334566 missense probably damaging 0.96
R3407:Arfgap3 UTSW 15 83322607 missense probably benign 0.00
R4072:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4074:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4206:Arfgap3 UTSW 15 83322668 missense probably benign
R4449:Arfgap3 UTSW 15 83334558 missense probably damaging 1.00
R5004:Arfgap3 UTSW 15 83310296 missense possibly damaging 0.87
R5193:Arfgap3 UTSW 15 83332697 missense probably benign 0.01
R5364:Arfgap3 UTSW 15 83314361 missense probably damaging 1.00
R6813:Arfgap3 UTSW 15 83330593 missense probably benign 0.00
R7154:Arfgap3 UTSW 15 83336704 missense probably damaging 1.00
R7422:Arfgap3 UTSW 15 83306949 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTAGTCCTGGACATCCTCCG -3'
(R):5'- ACCTCACCGAGTGAAGGAGAAC -3'

Sequencing Primer
(F):5'- TCCCCTTGCTGACGAAGGTTG -3'
(R):5'- TGAAGGAGAACGGCGCG -3'
Posted On2017-10-10