Incidental Mutation 'R6143:Dnpep'
ID488654
Institutional Source Beutler Lab
Gene Symbol Dnpep
Ensembl Gene ENSMUSG00000026209
Gene Nameaspartyl aminopeptidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75307896-75317990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75315228 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 214 (H214Y)
Ref Sequence ENSEMBL: ENSMUSP00000140877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066668] [ENSMUST00000113605] [ENSMUST00000185419] [ENSMUST00000185797] [ENSMUST00000187000] [ENSMUST00000187075] [ENSMUST00000187836] [ENSMUST00000188652] [ENSMUST00000189282] [ENSMUST00000189551] [ENSMUST00000191254]
Predicted Effect probably damaging
Transcript: ENSMUST00000066668
AA Change: H214Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070821
Gene: ENSMUSG00000026209
AA Change: H214Y

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 2.9e-199 PFAM
Pfam:Peptidase_M42 328 455 1.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113605
AA Change: H214Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109235
Gene: ENSMUSG00000026209
AA Change: H214Y

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185419
AA Change: H214Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140035
Gene: ENSMUSG00000026209
AA Change: H214Y

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 459 7.3e-192 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185797
AA Change: H216Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140864
Gene: ENSMUSG00000026209
AA Change: H216Y

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 462 2e-190 PFAM
Pfam:Peptidase_M42 330 457 1.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186278
Predicted Effect probably damaging
Transcript: ENSMUST00000187000
AA Change: H214Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141014
Gene: ENSMUSG00000026209
AA Change: H214Y

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 271 2.9e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187075
AA Change: H214Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140877
Gene: ENSMUSG00000026209
AA Change: H214Y

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 222 1.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187791
Predicted Effect probably damaging
Transcript: ENSMUST00000187836
AA Change: H214Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139739
Gene: ENSMUSG00000026209
AA Change: H214Y

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188652
SMART Domains Protein: ENSMUSP00000139532
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 85 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189282
SMART Domains Protein: ENSMUSP00000141187
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 57 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189551
SMART Domains Protein: ENSMUSP00000140563
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 198 6.4e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190005
Predicted Effect probably benign
Transcript: ENSMUST00000191254
SMART Domains Protein: ENSMUSP00000140997
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 64 8.8e-11 PFAM
Pfam:Peptidase_M18 60 92 3.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase which prefers acidic amino acids, and specifically favors aspartic acid over glutamic acid. It is thought to be a cytosolic protein involved in general metabolism of intracellular proteins. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Dnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Dnpep APN 1 75315688 missense probably damaging 1.00
P0026:Dnpep UTSW 1 75308685 missense probably benign 0.01
R0126:Dnpep UTSW 1 75312538 nonsense probably null
R0318:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R0669:Dnpep UTSW 1 75311778 unclassified probably benign
R1076:Dnpep UTSW 1 75315938 unclassified probably benign
R1478:Dnpep UTSW 1 75316027 missense probably damaging 1.00
R1803:Dnpep UTSW 1 75309414 nonsense probably null
R3409:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R3411:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R4590:Dnpep UTSW 1 75316401 missense probably damaging 1.00
R4863:Dnpep UTSW 1 75309230 intron probably benign
R4948:Dnpep UTSW 1 75316760 missense probably benign 0.13
R5873:Dnpep UTSW 1 75315143 missense probably damaging 1.00
R5891:Dnpep UTSW 1 75311812 missense probably benign
R5907:Dnpep UTSW 1 75311991 critical splice donor site probably null
R6432:Dnpep UTSW 1 75315378 missense probably benign 0.12
R6433:Dnpep UTSW 1 75315378 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAGTGCCACCAACTGGGAAG -3'
(R):5'- GAGTCCCTATTCTTGCCACAG -3'

Sequencing Primer
(F):5'- TGAGACTAACTGAGGAGCTTCG -3'
(R):5'- TGCCACAGCAGTTCAGG -3'
Posted On2017-10-10