Incidental Mutation 'R0525:Rslcan18'
ID48868
Institutional Source Beutler Lab
Gene Symbol Rslcan18
Ensembl Gene ENSMUSG00000074824
Gene Nameregulator of sex-limitation candidate 18
Synonyms
MMRRC Submission 038718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0525 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67096613-67116263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67112258 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 25 (V25A)
Ref Sequence ENSEMBL: ENSMUSP00000089111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091526] [ENSMUST00000186303]
Predicted Effect probably benign
Transcript: ENSMUST00000091526
AA Change: V25A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000089111
Gene: ENSMUSG00000074824
AA Change: V25A

DomainStartEndE-ValueType
KRAB 96 156 5.31e-28 SMART
ZnF_C2H2 171 193 4.24e-4 SMART
ZnF_C2H2 199 221 1.56e-2 SMART
ZnF_C2H2 227 249 1.82e-3 SMART
ZnF_C2H2 255 277 1.82e-3 SMART
ZnF_C2H2 283 305 3.26e-5 SMART
ZnF_C2H2 311 333 1.82e-3 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 2.12e-4 SMART
ZnF_C2H2 395 417 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186303
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225558
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 125,331,499 noncoding transcript Het
A930002H24Rik A G 17: 63,863,647 W49R unknown Het
Abca13 G A 11: 9,293,371 V1745M probably damaging Het
Abca16 T G 7: 120,465,810 Y563* probably null Het
Acot12 C T 13: 91,760,067 probably benign Het
Alms1 G A 6: 85,587,760 A39T unknown Het
Arid5b T C 10: 68,097,846 D742G possibly damaging Het
Atp1a4 G A 1: 172,239,688 probably benign Het
AU021092 T A 16: 5,217,861 E145V possibly damaging Het
Calr4 A T 4: 109,242,264 probably benign Het
Clip4 T A 17: 71,799,098 probably null Het
Cnpy4 A T 5: 138,192,616 H180L probably benign Het
Cyp2j9 T C 4: 96,579,565 probably null Het
Dgkq A G 5: 108,654,615 S406P probably damaging Het
Dhx8 G A 11: 101,763,928 C1014Y probably damaging Het
Dnah3 T C 7: 119,928,754 Y3824C probably damaging Het
Donson A T 16: 91,686,245 H69Q probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Drg1 A G 11: 3,262,545 F96L probably damaging Het
Dvl1 A C 4: 155,855,595 T395P probably damaging Het
Eftud2 A T 11: 102,839,253 V897D probably damaging Het
Enpp6 A G 8: 47,082,443 N341S possibly damaging Het
F11 A G 8: 45,253,049 F100L probably benign Het
Fas T C 19: 34,319,327 Y189H probably damaging Het
Galnt14 G T 17: 73,545,081 S114R probably damaging Het
Gfpt2 A G 11: 49,829,775 I528V probably benign Het
Glt6d1 A G 2: 25,794,268 V242A possibly damaging Het
Grm1 A T 10: 10,719,209 probably benign Het
Gskip G A 12: 105,698,965 A88T probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Hnrnpul1 C A 7: 25,740,883 R316L possibly damaging Het
Il34 T C 8: 110,748,283 E121G probably damaging Het
Lrr1 T C 12: 69,168,911 L19P probably damaging Het
Mat2b A G 11: 40,682,669 probably benign Het
Mettl21e T C 1: 44,206,382 K235E probably damaging Het
Mir124-2hg T A 3: 17,785,529 E126V possibly damaging Het
Myh15 A G 16: 49,132,051 K828R probably benign Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Nek5 C A 8: 22,079,077 probably benign Het
Nudt7 A T 8: 114,151,652 probably null Het
Olfr1056 C T 2: 86,356,275 V36I probably benign Het
Olfr1118 A T 2: 87,309,349 T187S probably benign Het
Olfr1200 G A 2: 88,767,314 Q334* probably null Het
Olfr350 T C 2: 36,850,190 L48P probably damaging Het
Olfr961 T G 9: 39,647,471 C248W probably damaging Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Pmch T C 10: 88,091,400 probably benign Het
Ror1 A G 4: 100,441,520 S697G probably damaging Het
Sema6b T C 17: 56,126,630 H426R probably damaging Het
Serpina3g T C 12: 104,238,339 F9S probably damaging Het
Serpinb12 T A 1: 106,946,702 H52Q probably benign Het
Sh3gl1 T C 17: 56,017,873 K294R probably benign Het
Sidt1 G T 16: 44,259,446 T615K possibly damaging Het
Slc16a4 A C 3: 107,297,939 probably benign Het
Sned1 T A 1: 93,271,974 probably null Het
Sp2 A T 11: 96,956,098 probably benign Het
Steap1 T A 5: 5,742,903 I3F possibly damaging Het
Stxbp5l A T 16: 37,129,797 probably null Het
Tbc1d9 G T 8: 83,268,985 V968F probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Triobp T C 15: 78,973,898 L1233P possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpc4ap A G 2: 155,640,478 F531L possibly damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Vmn1r86 T C 7: 13,102,161 K213E probably benign Het
Vps8 G A 16: 21,540,109 probably null Het
Wnk1 A T 6: 119,926,564 S2563T probably damaging Het
Yrdc C G 4: 124,851,766 R3G probably damaging Het
Zfp287 A T 11: 62,715,244 V279E probably benign Het
Other mutations in Rslcan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Rslcan18 APN 13 67102108 missense probably benign 0.01
IGL01760:Rslcan18 APN 13 67113951 missense probably benign 0.04
R0003:Rslcan18 UTSW 13 67098469 missense probably benign 0.01
R0333:Rslcan18 UTSW 13 67098622 missense probably damaging 0.99
R0505:Rslcan18 UTSW 13 67102119 missense probably benign 0.31
R0898:Rslcan18 UTSW 13 67098816 missense probably benign 0.02
R1449:Rslcan18 UTSW 13 67102100 missense possibly damaging 0.65
R1511:Rslcan18 UTSW 13 67098952 missense possibly damaging 0.94
R1575:Rslcan18 UTSW 13 67108057 intron probably benign
R1973:Rslcan18 UTSW 13 67108023 intron probably benign
R3109:Rslcan18 UTSW 13 67098607 missense possibly damaging 0.53
R4707:Rslcan18 UTSW 13 67098526 missense probably damaging 1.00
R5277:Rslcan18 UTSW 13 67098434 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGCTCCACTCACAGGCTAAATTC -3'
(R):5'- TCTGTTTCCCAAACAAGCCCGAG -3'

Sequencing Primer
(F):5'- CTCACAGGCTAAATTCGGGTG -3'
(R):5'- GAGTCAGCTCTCTACGCAC -3'
Posted On2013-06-12