Incidental Mutation 'R6143:Myo5c'
ID488684
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75249809 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 176 (R176G)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably damaging
Transcript: ENSMUST00000036555
AA Change: R176G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: R176G

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000216788
AA Change: R176G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTTCAGGAACAGGTCTTG -3'
(R):5'- ACAGAACTTGTATCCCTGTTCTTG -3'

Sequencing Primer
(F):5'- CCTCTTCAGGAACAGGTCTTGATATG -3'
(R):5'- GGTCTTTAAGGGAAGAAGTCTCATC -3'
Posted On2017-10-10