Incidental Mutation 'R6144:Sbds'
ID488731
Institutional Source Beutler Lab
Gene Symbol Sbds
Ensembl Gene ENSMUSG00000025337
Gene NameSBDS ribosome maturation factor
SynonymsCGI-97, 4733401P19Rik
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location130245731-130255530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130246344 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 248 (K248E)
Ref Sequence ENSEMBL: ENSMUSP00000026387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026387] [ENSMUST00000065329] [ENSMUST00000111298] [ENSMUST00000125625] [ENSMUST00000139211]
Predicted Effect probably benign
Transcript: ENSMUST00000026387
AA Change: K248E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026387
Gene: ENSMUSG00000025337
AA Change: K248E

DomainStartEndE-ValueType
Pfam:SBDS 14 101 1.2e-36 PFAM
Pfam:SBDS_C 107 225 2.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065329
SMART Domains Protein: ENSMUSP00000067501
Gene: ENSMUSG00000053094

DomainStartEndE-ValueType
Pfam:TMEM219 10 258 1.7e-97 PFAM
transmembrane domain 268 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111298
SMART Domains Protein: ENSMUSP00000106929
Gene: ENSMUSG00000053094

DomainStartEndE-ValueType
Pfam:TMEM219 10 257 1.8e-86 PFAM
transmembrane domain 268 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125625
SMART Domains Protein: ENSMUSP00000115494
Gene: ENSMUSG00000025337

DomainStartEndE-ValueType
Pfam:SBDS 3 66 2.1e-25 PFAM
Pfam:SBDS_C 69 173 9.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201598
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: This gene encodes a protein that is necessary for ribosome function and maintaining normal levels of protein synthesis. The encoded protein may function to activate ribosomes for translation, and may be involved in cellular response to stress and DNA damage. Loss of this gene is embryonic lethal while deficiency of the encoded protein in the pancreas is associated with symptoms of Shwachman-Diamond syndrome. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation and failure of gastrulation. Heterozygotes for the same allele are viable and fertile with no signs of Shwachman-Diamond syndrome related abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Sbds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Sbds APN 5 130254066 missense probably damaging 1.00
IGL02111:Sbds APN 5 130250941 missense probably damaging 1.00
R0421:Sbds UTSW 5 130253933 unclassified probably benign
R0546:Sbds UTSW 5 130254078 missense possibly damaging 0.93
R4693:Sbds UTSW 5 130250975 missense probably damaging 1.00
R5527:Sbds UTSW 5 130246406 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCAGCTGTTCTGGACTCTG -3'
(R):5'- GCTTATTCTGTGCCGATGC -3'

Sequencing Primer
(F):5'- TTTGCTGGAAACCCCAATTGAC -3'
(R):5'- GATGCCCATCTTCCCTTGGAAAC -3'
Posted On2017-10-10