Incidental Mutation 'R6144:Alms1'
ID488734
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene NameALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85587531-85702753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85623074 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2096 (D2096E)
Ref Sequence ENSEMBL: ENSMUSP00000148796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
Predicted Effect probably damaging
Transcript: ENSMUST00000072018
AA Change: D1627E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: D1627E

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213058
AA Change: D2096E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGAACCTGAAGGCTGCAGTAC -3'
(R):5'- GTAAACAAGCGTGGCTGTG -3'

Sequencing Primer
(F):5'- CTGCAGTACAGGCATTGGG -3'
(R):5'- TGCCTATTATGTCAGTGAGTCC -3'
Posted On2017-10-10