Incidental Mutation 'R6144:Agbl1'
ID488739
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76420084 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000026854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect probably benign
Transcript: ENSMUST00000026854
AA Change: T203A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107442
AA Change: T203A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156166
AA Change: T455A
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: T455A

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTTTTAACCGGGAGCACAG -3'
(R):5'- CTTGAATCCCACAGCAGATCTTG -3'

Sequencing Primer
(F):5'- GCACAGCTCCTGGAGACAAG -3'
(R):5'- ACAGCAGATCTTGTTCTCATAGC -3'
Posted On2017-10-10