Incidental Mutation 'R0525:Stxbp5l'
ID 48874
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 038718-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0525 (G1)
Quality Score 216
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 36950159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114780
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 124,930,671 (GRCm39) noncoding transcript Het
A930002H24Rik A G 17: 64,170,642 (GRCm39) W49R unknown Het
Abca13 G A 11: 9,243,371 (GRCm39) V1745M probably damaging Het
Abca16 T G 7: 120,065,033 (GRCm39) Y563* probably null Het
Acot12 C T 13: 91,908,186 (GRCm39) probably benign Het
Alms1 G A 6: 85,564,742 (GRCm39) A39T unknown Het
Arid5b T C 10: 67,933,676 (GRCm39) D742G possibly damaging Het
Atp1a4 G A 1: 172,067,255 (GRCm39) probably benign Het
AU021092 T A 16: 5,035,725 (GRCm39) E145V possibly damaging Het
Calr4 A T 4: 109,099,461 (GRCm39) probably benign Het
Clip4 T A 17: 72,106,093 (GRCm39) probably null Het
Cnpy4 A T 5: 138,190,878 (GRCm39) H180L probably benign Het
Cyp2j9 T C 4: 96,467,802 (GRCm39) probably null Het
Dgkq A G 5: 108,802,481 (GRCm39) S406P probably damaging Het
Dhx8 G A 11: 101,654,754 (GRCm39) C1014Y probably damaging Het
Dnah3 T C 7: 119,527,977 (GRCm39) Y3824C probably damaging Het
Donson A T 16: 91,483,133 (GRCm39) H69Q probably damaging Het
Dppa3 A G 6: 122,606,939 (GRCm39) E143G probably damaging Het
Drg1 A G 11: 3,212,545 (GRCm39) F96L probably damaging Het
Dvl1 A C 4: 155,940,052 (GRCm39) T395P probably damaging Het
Eftud2 A T 11: 102,730,079 (GRCm39) V897D probably damaging Het
Enpp6 A G 8: 47,535,478 (GRCm39) N341S possibly damaging Het
F11 A G 8: 45,706,086 (GRCm39) F100L probably benign Het
Fas T C 19: 34,296,727 (GRCm39) Y189H probably damaging Het
Galnt14 G T 17: 73,852,076 (GRCm39) S114R probably damaging Het
Gfpt2 A G 11: 49,720,602 (GRCm39) I528V probably benign Het
Glt6d1 A G 2: 25,684,280 (GRCm39) V242A possibly damaging Het
Grm1 A T 10: 10,594,953 (GRCm39) probably benign Het
Gskip G A 12: 105,665,224 (GRCm39) A88T probably damaging Het
Gtpbp1 A G 15: 79,597,648 (GRCm39) I348V probably benign Het
Hnrnpul1 C A 7: 25,440,308 (GRCm39) R316L possibly damaging Het
Il34 T C 8: 111,474,915 (GRCm39) E121G probably damaging Het
Lrr1 T C 12: 69,215,685 (GRCm39) L19P probably damaging Het
Mat2b A G 11: 40,573,496 (GRCm39) probably benign Het
Mettl21e T C 1: 44,245,542 (GRCm39) K235E probably damaging Het
Mir124-2hg T A 3: 17,839,693 (GRCm39) E126V possibly damaging Het
Myh15 A G 16: 48,952,414 (GRCm39) K828R probably benign Het
Myom3 A G 4: 135,492,237 (GRCm39) D127G possibly damaging Het
Nek5 C A 8: 22,569,093 (GRCm39) probably benign Het
Nudt7 A T 8: 114,878,392 (GRCm39) probably null Het
Or10ag56 A T 2: 87,139,693 (GRCm39) T187S probably benign Het
Or10d4c T G 9: 39,558,767 (GRCm39) C248W probably damaging Het
Or1j4 T C 2: 36,740,202 (GRCm39) L48P probably damaging Het
Or4a67 G A 2: 88,597,658 (GRCm39) Q334* probably null Het
Or8k23 C T 2: 86,186,619 (GRCm39) V36I probably benign Het
Phyhd1 A G 2: 30,171,040 (GRCm39) H241R probably damaging Het
Pmch T C 10: 87,927,262 (GRCm39) probably benign Het
Ror1 A G 4: 100,298,717 (GRCm39) S697G probably damaging Het
Rslcan18 A G 13: 67,260,322 (GRCm39) V25A probably benign Het
Sema6b T C 17: 56,433,630 (GRCm39) H426R probably damaging Het
Serpina3g T C 12: 104,204,598 (GRCm39) F9S probably damaging Het
Serpinb12 T A 1: 106,874,432 (GRCm39) H52Q probably benign Het
Sh3gl1 T C 17: 56,324,873 (GRCm39) K294R probably benign Het
Sidt1 G T 16: 44,079,809 (GRCm39) T615K possibly damaging Het
Slc16a4 A C 3: 107,205,255 (GRCm39) probably benign Het
Sned1 T A 1: 93,199,696 (GRCm39) probably null Het
Sp2 A T 11: 96,846,924 (GRCm39) probably benign Het
Steap1 T A 5: 5,792,903 (GRCm39) I3F possibly damaging Het
Tbc1d9 G T 8: 83,995,614 (GRCm39) V968F probably benign Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Triobp T C 15: 78,858,098 (GRCm39) L1233P possibly damaging Het
Trp53bp1 C A 2: 121,082,349 (GRCm39) A317S probably null Het
Trpc4ap A G 2: 155,482,398 (GRCm39) F531L possibly damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Vmn1r86 T C 7: 12,836,088 (GRCm39) K213E probably benign Het
Vps8 G A 16: 21,358,859 (GRCm39) probably null Het
Wnk1 A T 6: 119,903,525 (GRCm39) S2563T probably damaging Het
Yrdc C G 4: 124,745,559 (GRCm39) R3G probably damaging Het
Zfp287 A T 11: 62,606,070 (GRCm39) V279E probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37,024,883 (GRCm39) missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37,068,231 (GRCm39) critical splice donor site probably null
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37,111,289 (GRCm39) critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37,008,991 (GRCm39) missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8961:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9226:Stxbp5l UTSW 16 37,076,206 (GRCm39) missense probably damaging 0.96
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCTGCATTTAATTCCTAGCACCTCAA -3'
(R):5'- TCAGCTTACCTAGTCTTCGCCCA -3'

Sequencing Primer
(F):5'- GCCAGTATGATTAAAATAAAACTCCC -3'
(R):5'- AATGTTGGATGTTAATTATTTGCCAC -3'
Posted On 2013-06-12