Incidental Mutation 'R6144:Nckipsd'
ID488745
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene NameNCK interacting protein with SH3 domain
SynonymsAF3P21, Wasbp, SPIN90, DIP1, WISH, ORF1
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R6144 (G1)
Quality Score218.009
Status Validated
Chromosome9
Chromosomal Location108808368-108818844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108812386 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably damaging
Transcript: ENSMUST00000035218
AA Change: S249P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: S249P

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192180
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194413
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108814969 missense probably benign 0.07
IGL01601:Nckipsd APN 9 108813955 missense probably benign 0.00
IGL01809:Nckipsd APN 9 108817554 missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108811614 missense probably benign
R0714:Nckipsd UTSW 9 108814134 unclassified probably benign
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108812372 missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108814664 splice site probably null
R2127:Nckipsd UTSW 9 108811733 missense probably benign
R3697:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108814076 missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108814739 missense probably benign 0.28
R4879:Nckipsd UTSW 9 108813915 unclassified probably benign
R5796:Nckipsd UTSW 9 108811614 missense probably benign
R5891:Nckipsd UTSW 9 108808609 missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108812236 missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108813977 missense probably benign 0.00
R6403:Nckipsd UTSW 9 108811683 missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108814081 missense probably benign 0.30
Y4335:Nckipsd UTSW 9 108817545 missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108814677 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTTCTTGTTCACAGGTGGCC -3'
(R):5'- TCATGGCTTAGACCGGTGTTTC -3'

Sequencing Primer
(F):5'- CGCACAGCCATACCCTCTGG -3'
(R):5'- GCACGAGTTCCATCAGCTCTG -3'
Posted On2017-10-10