Incidental Mutation 'R6144:Olfr747'
ID488763
Institutional Source Beutler Lab
Gene Symbol Olfr747
Ensembl Gene ENSMUSG00000057179
Gene Nameolfactory receptor 747
SynonymsGA_x6K02T2PMLR-6420220-6419279, MOR106-7, MOR106-16
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50680657-50693206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50680935 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 233 (R233L)
Ref Sequence ENSEMBL: ENSMUSP00000149081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078075] [ENSMUST00000205373] [ENSMUST00000205897] [ENSMUST00000213238]
Predicted Effect probably benign
Transcript: ENSMUST00000078075
AA Change: R233L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077220
Gene: ENSMUSG00000057179
AA Change: R233L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-53 PFAM
Pfam:7tm_1 40 289 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205373
AA Change: R233L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000205897
Predicted Effect probably benign
Transcript: ENSMUST00000213238
AA Change: R233L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Olfr747
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Olfr747 APN 14 50681200 missense probably benign 0.04
R0349:Olfr747 UTSW 14 50681254 missense probably benign 0.00
R0613:Olfr747 UTSW 14 50681404 missense probably benign 0.06
R1023:Olfr747 UTSW 14 50681016 missense probably damaging 1.00
R1126:Olfr747 UTSW 14 50681263 missense possibly damaging 0.94
R1298:Olfr747 UTSW 14 50680880 nonsense probably null
R1344:Olfr747 UTSW 14 50680858 missense probably benign
R1775:Olfr747 UTSW 14 50681166 missense possibly damaging 0.66
R1928:Olfr747 UTSW 14 50681415 missense probably benign 0.00
R2208:Olfr747 UTSW 14 50681563 missense probably benign 0.01
R4181:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4183:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4184:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R5104:Olfr747 UTSW 14 50680702 nonsense probably null
R6768:Olfr747 UTSW 14 50681592 missense probably damaging 1.00
R7026:Olfr747 UTSW 14 50681259 missense probably damaging 0.98
R7454:Olfr747 UTSW 14 50680824 missense possibly damaging 0.94
X0067:Olfr747 UTSW 14 50681529 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCCTAACAGAACTTTCCTCAGAGC -3'
(R):5'- TGATCACTTCCTCTGTGACATG -3'

Sequencing Primer
(F):5'- CAGAGCAAGTTTCATGTCCTTG -3'
(R):5'- TGACATGGACCCATTGATGGC -3'
Posted On2017-10-10