Incidental Mutation 'R6144:Itgb7'
ID488769
Institutional Source Beutler Lab
Gene Symbol Itgb7
Ensembl Gene ENSMUSG00000001281
Gene Nameintegrin beta 7
Synonyms
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102215995-102231944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102223482 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 222 (R222L)
Ref Sequence ENSEMBL: ENSMUSP00000001327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001327] [ENSMUST00000127014] [ENSMUST00000230652]
Predicted Effect probably benign
Transcript: ENSMUST00000001327
AA Change: R222L

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001327
Gene: ENSMUSG00000001281
AA Change: R222L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 44 92 6.35e-6 SMART
INB 50 476 2.82e-273 SMART
VWA 151 383 7.52e-2 SMART
low complexity region 537 557 N/A INTRINSIC
Pfam:EGF_2 605 635 2.6e-7 PFAM
Integrin_B_tail 645 721 4.22e-18 SMART
low complexity region 732 744 N/A INTRINSIC
Integrin_b_cyt 746 792 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127014
SMART Domains Protein: ENSMUSP00000123227
Gene: ENSMUSG00000001281

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PSI 48 85 4.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230652
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms dimers with an alpha4 chain or an alphaE chain and plays a role in leukocyte adhesion. Dimerization with alpha4 forms a homing receptor for migration of lymphocytes to the intestinal mucosa and Peyer's patches. Dimerization with alphaE permits binding to the ligand epithelial cadherin, a calcium-dependent adhesion molecule. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display hypoplasia of gut-associated lymph tissue due to defects in lymphocyte migration [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Itgb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Itgb7 APN 15 102227585 missense probably benign 0.22
IGL01574:Itgb7 APN 15 102227540 missense possibly damaging 0.83
IGL01814:Itgb7 APN 15 102223417 missense possibly damaging 0.78
IGL01875:Itgb7 APN 15 102217995 missense probably damaging 1.00
IGL01996:Itgb7 APN 15 102217977 missense probably damaging 1.00
IGL02320:Itgb7 APN 15 102224337 missense probably benign 0.04
IGL02541:Itgb7 APN 15 102223457 missense probably benign 0.05
IGL02547:Itgb7 APN 15 102218510 missense probably damaging 1.00
R0083:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0108:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0195:Itgb7 UTSW 15 102222183 unclassified probably benign
R1033:Itgb7 UTSW 15 102223554 missense probably damaging 1.00
R1627:Itgb7 UTSW 15 102223476 missense probably damaging 0.97
R1999:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2150:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2331:Itgb7 UTSW 15 102223548 missense probably damaging 1.00
R3747:Itgb7 UTSW 15 102222777 missense probably damaging 1.00
R4758:Itgb7 UTSW 15 102216207 missense probably benign 0.07
R4779:Itgb7 UTSW 15 102224413 missense possibly damaging 0.54
R5134:Itgb7 UTSW 15 102217407 missense probably damaging 1.00
R5158:Itgb7 UTSW 15 102217029 missense probably benign 0.05
R5323:Itgb7 UTSW 15 102231624 intron probably benign
R5416:Itgb7 UTSW 15 102217309 missense probably benign 0.00
R5652:Itgb7 UTSW 15 102216203 missense possibly damaging 0.48
R6089:Itgb7 UTSW 15 102217286 missense probably benign 0.00
R6384:Itgb7 UTSW 15 102224451 missense probably benign 0.04
R6475:Itgb7 UTSW 15 102216266 missense probably benign 0.12
R6754:Itgb7 UTSW 15 102216160 makesense probably null
R6857:Itgb7 UTSW 15 102223465 missense probably damaging 1.00
R7394:Itgb7 UTSW 15 102219254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTCAGATCCTAACCCTATC -3'
(R):5'- AAGCCTGGATGCTGCTGTTG -3'

Sequencing Primer
(F):5'- CCCTATCTCACCTGGCAGAG -3'
(R):5'- CAGGTCCCTGTCATCTAGGTG -3'
Posted On2017-10-10