Incidental Mutation 'R6145:Ep400'
ID488809
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110756703 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 10 (V10D)
Ref Sequence ENSEMBL: ENSMUSP00000138369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000146458]
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: V10D
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: V10D

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112433
AA Change: V10D

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505
AA Change: V10D

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: V10D
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: V10D

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: V10D
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: V10D

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146458
AA Change: V10D

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505
AA Change: V10D

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178031
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 intron probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 intron probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCCAACATTCTGCAGTGTG -3'
(R):5'- ATCAGATGCCAGTGTGAATGTAC -3'

Sequencing Primer
(F):5'- CAACATTCTGCAGTGTGATGTTC -3'
(R):5'- CATTCAGTATGTTTTCAGGGCTAC -3'
Posted On2017-10-10