Incidental Mutation 'R6147:Ranbp2'
ID488963
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58479428 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1990 (T1990K)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably damaging
Transcript: ENSMUST00000003310
AA Change: T1990K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: T1990K

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Camsap2 G A 1: 136,345,400 T13M probably damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mpeg1 T G 19: 12,462,894 I572S probably damaging Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr109 T C 17: 37,466,539 I111T probably benign Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Sntb1 T A 15: 55,648,010 M393L probably benign Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tbck A G 3: 132,694,446 K86R probably benign Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim34a A T 7: 104,261,191 Q400L probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vmn2r11 C T 5: 109,054,834 V126M probably benign Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGAACCTGAAGCCTCTCTCG -3'
(R):5'- GTTATCCCATTCTAAGGCAGGC -3'

Sequencing Primer
(F):5'- CTCTCGGGGTCAGATAGAGCATG -3'
(R):5'- TAAGGCAGGCCCGGTGTTATC -3'
Posted On2017-10-10