Incidental Mutation 'R6148:Cfap69'
ID489006
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
MMRRC Submission 044295-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6148 (G1)
Quality Score126.008
Status Validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5663996 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 12 (D12G)
Ref Sequence ENSEMBL: ENSMUSP00000143393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000061008] [ENSMUST00000115426] [ENSMUST00000115427] [ENSMUST00000132510] [ENSMUST00000135252] [ENSMUST00000148193] [ENSMUST00000164219] [ENSMUST00000196165]
Predicted Effect probably benign
Transcript: ENSMUST00000054865
AA Change: D12G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: D12G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000061008
AA Change: D12G
SMART Domains Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473
AA Change: D12G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115426
SMART Domains Protein: ENSMUSP00000111086
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115427
SMART Domains Protein: ENSMUSP00000111087
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 2.3e-17 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 401 1.8e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132510
AA Change: D12G
SMART Domains Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473
AA Change: D12G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135252
AA Change: D12G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473
AA Change: D12G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148193
Predicted Effect probably benign
Transcript: ENSMUST00000164219
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196165
AA Change: D12G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: D12G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198121
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 95% (61/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,187,426 C1067S possibly damaging Het
Agbl3 T A 6: 34,857,753 S952R possibly damaging Het
Ano9 A G 7: 141,106,785 Y429H probably damaging Het
Bbs7 C A 3: 36,613,266 R7L probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Catsper4 A G 4: 134,217,929 V206A probably damaging Het
Ccdc73 T G 2: 104,992,137 S810R possibly damaging Het
Cd177 A T 7: 24,744,273 L800* probably null Het
Cd34 T C 1: 194,948,008 probably null Het
Cep78 G A 19: 15,981,786 R95* probably null Het
Cpne7 A G 8: 123,127,432 D286G probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cxcl5 A T 5: 90,759,706 I46L probably benign Het
Cyp19a1 C T 9: 54,180,256 G59D probably damaging Het
Dclre1c A G 2: 3,437,705 D35G probably damaging Het
Dvl1 A G 4: 155,854,952 Y279C probably damaging Het
Fes A G 7: 80,380,296 L578P probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fmn2 T C 1: 174,666,663 S1248P probably damaging Het
Fmo1 T G 1: 162,851,519 S53R probably damaging Het
Gabrg1 A T 5: 70,774,461 M313K probably damaging Het
Galnt10 T C 11: 57,784,648 C578R probably damaging Het
Gm13178 T C 4: 144,721,317 T30A possibly damaging Het
Gm15293 A G 8: 21,202,412 N83S probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Gsap A G 5: 21,226,325 R216G probably damaging Het
Gsap A T 5: 21,270,577 T570S probably benign Het
Gucy2d A T 7: 98,443,823 I136L probably benign Het
Hap1 A T 11: 100,349,392 V294E probably damaging Het
Ipo8 A G 6: 148,799,780 V514A probably damaging Het
Irf5 T C 6: 29,535,959 L324P probably damaging Het
Itsn1 C T 16: 91,816,852 R251C probably damaging Het
Klf11 T C 12: 24,651,568 probably null Het
Kpna6 G A 4: 129,649,306 Q439* probably null Het
Mark4 A T 7: 19,429,516 S563T probably benign Het
Mrpl21 A T 19: 3,283,084 I5L probably benign Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myrf G A 19: 10,212,475 T815I probably damaging Het
Olfr1211 C T 2: 88,930,253 V21I probably benign Het
Olfr515-ps1 A T 7: 108,844,971 probably null Het
Olfr665 A G 7: 104,881,082 Y125C possibly damaging Het
Olfr743 A G 14: 50,534,321 N303S probably benign Het
Olfr961 G T 9: 39,647,259 D178Y probably damaging Het
Os9 T C 10: 127,099,943 D280G probably benign Het
Pcdhb14 A G 18: 37,449,230 N463S probably damaging Het
Pex19 G A 1: 172,134,039 E271K probably damaging Het
Ppdpf G A 2: 181,187,848 S32N probably benign Het
Prdm2 A G 4: 143,132,907 I1271T probably benign Het
Rbbp4 T C 4: 129,321,958 T262A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sult1e1 A T 5: 87,579,911 S171T probably damaging Het
Tns1 T C 1: 73,953,453 T689A probably damaging Het
Unc13c G C 9: 73,693,366 N1365K probably benign Het
Vmn2r52 T C 7: 10,171,163 I250V probably benign Het
Vmn2r55 C A 7: 12,668,142 L406F probably benign Het
Wdcp T C 12: 4,850,621 V159A possibly damaging Het
Zbtb3 C T 19: 8,804,196 A391V probably benign Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0702:Cfap69 UTSW 5 5644465 missense probably benign 0.27
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1857:Cfap69 UTSW 5 5582518 missense possibly damaging 0.92
R1916:Cfap69 UTSW 5 5663970 missense probably damaging 0.99
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R2939:Cfap69 UTSW 5 5644432 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R4932:Cfap69 UTSW 5 5625820 missense probably damaging 1.00
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5258:Cfap69 UTSW 5 5604271 splice site probably null
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6550:Cfap69 UTSW 5 5581220 missense probably benign 0.03
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
R7455:Cfap69 UTSW 5 5625873 missense possibly damaging 0.92
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGATCAGCTGGGCTATCATTATC -3'
(R):5'- TGGGCACTAACAGCAGTTGG -3'

Sequencing Primer
(F):5'- ACAGGTTCCCAAATCTCATTCTGG -3'
(R):5'- ACAGCAGTTGGATGTCCG -3'
Posted On2017-10-10