Incidental Mutation 'R6148:Wdcp'
ID489036
Institutional Source Beutler Lab
Gene Symbol Wdcp
Ensembl Gene ENSMUSG00000051721
Gene NameWD repeat and coiled coil containing
SynonymsBC068281
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R6148 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4843303-4860043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4850621 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 159 (V159A)
Ref Sequence ENSEMBL: ENSMUSP00000151585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053034] [ENSMUST00000085793] [ENSMUST00000220170] [ENSMUST00000220215] [ENSMUST00000223551]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053034
AA Change: V159A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054102
Gene: ENSMUSG00000051721
AA Change: V159A

DomainStartEndE-ValueType
Pfam:DUF4613 2 610 1.9e-260 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000085793
AA Change: V159A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082948
Gene: ENSMUSG00000051721
AA Change: V159A

DomainStartEndE-ValueType
Pfam:DUF4613 2 643 2.4e-280 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219069
Predicted Effect possibly damaging
Transcript: ENSMUST00000220170
AA Change: V159A

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220215
AA Change: V159A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223551
AA Change: V159A

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 95% (61/64)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,187,426 C1067S possibly damaging Het
Agbl3 T A 6: 34,857,753 S952R possibly damaging Het
Ano9 A G 7: 141,106,785 Y429H probably damaging Het
Bbs7 C A 3: 36,613,266 R7L probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Catsper4 A G 4: 134,217,929 V206A probably damaging Het
Ccdc73 T G 2: 104,992,137 S810R possibly damaging Het
Cd177 A T 7: 24,744,273 L800* probably null Het
Cd34 T C 1: 194,948,008 probably null Het
Cep78 G A 19: 15,981,786 R95* probably null Het
Cfap69 T C 5: 5,663,996 D12G probably benign Het
Cpne7 A G 8: 123,127,432 D286G probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cxcl5 A T 5: 90,759,706 I46L probably benign Het
Cyp19a1 C T 9: 54,180,256 G59D probably damaging Het
Dclre1c A G 2: 3,437,705 D35G probably damaging Het
Dvl1 A G 4: 155,854,952 Y279C probably damaging Het
Fes A G 7: 80,380,296 L578P probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fmn2 T C 1: 174,666,663 S1248P probably damaging Het
Fmo1 T G 1: 162,851,519 S53R probably damaging Het
Gabrg1 A T 5: 70,774,461 M313K probably damaging Het
Galnt10 T C 11: 57,784,648 C578R probably damaging Het
Gm13178 T C 4: 144,721,317 T30A possibly damaging Het
Gm15293 A G 8: 21,202,412 N83S probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Gsap A G 5: 21,226,325 R216G probably damaging Het
Gsap A T 5: 21,270,577 T570S probably benign Het
Gucy2d A T 7: 98,443,823 I136L probably benign Het
Hap1 A T 11: 100,349,392 V294E probably damaging Het
Ipo8 A G 6: 148,799,780 V514A probably damaging Het
Irf5 T C 6: 29,535,959 L324P probably damaging Het
Itsn1 C T 16: 91,816,852 R251C probably damaging Het
Klf11 T C 12: 24,651,568 probably null Het
Kpna6 G A 4: 129,649,306 Q439* probably null Het
Mark4 A T 7: 19,429,516 S563T probably benign Het
Mrpl21 A T 19: 3,283,084 I5L probably benign Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myrf G A 19: 10,212,475 T815I probably damaging Het
Olfr1211 C T 2: 88,930,253 V21I probably benign Het
Olfr515-ps1 A T 7: 108,844,971 probably null Het
Olfr665 A G 7: 104,881,082 Y125C possibly damaging Het
Olfr743 A G 14: 50,534,321 N303S probably benign Het
Olfr961 G T 9: 39,647,259 D178Y probably damaging Het
Os9 T C 10: 127,099,943 D280G probably benign Het
Pcdhb14 A G 18: 37,449,230 N463S probably damaging Het
Pex19 G A 1: 172,134,039 E271K probably damaging Het
Ppdpf G A 2: 181,187,848 S32N probably benign Het
Prdm2 A G 4: 143,132,907 I1271T probably benign Het
Rbbp4 T C 4: 129,321,958 T262A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sult1e1 A T 5: 87,579,911 S171T probably damaging Het
Tns1 T C 1: 73,953,453 T689A probably damaging Het
Unc13c G C 9: 73,693,366 N1365K probably benign Het
Vmn2r52 T C 7: 10,171,163 I250V probably benign Het
Vmn2r55 C A 7: 12,668,142 L406F probably benign Het
Zbtb3 C T 19: 8,804,196 A391V probably benign Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Wdcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL00774:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL02327:Wdcp APN 12 4851115 missense possibly damaging 0.95
IGL02725:Wdcp APN 12 4851206 missense probably damaging 1.00
IGL03377:Wdcp APN 12 4850691 nonsense probably null
IGL03381:Wdcp APN 12 4851926 missense probably damaging 1.00
R0152:Wdcp UTSW 12 4851583 missense probably benign 0.06
R0317:Wdcp UTSW 12 4851583 missense probably benign 0.06
R1077:Wdcp UTSW 12 4850685 missense probably damaging 1.00
R1136:Wdcp UTSW 12 4851655 missense possibly damaging 0.78
R1571:Wdcp UTSW 12 4851924 nonsense probably null
R1653:Wdcp UTSW 12 4851815 missense probably damaging 1.00
R1848:Wdcp UTSW 12 4850245 missense possibly damaging 0.86
R4091:Wdcp UTSW 12 4855279 missense probably null 0.00
R5126:Wdcp UTSW 12 4850617 missense probably damaging 0.98
R6529:Wdcp UTSW 12 4851143 missense probably damaging 1.00
R6800:Wdcp UTSW 12 4851358 missense probably damaging 1.00
U24488:Wdcp UTSW 12 4850405 missense probably damaging 1.00
X0026:Wdcp UTSW 12 4851077 nonsense probably null
Z1088:Wdcp UTSW 12 4850825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCTTGTCTCCGTGTG -3'
(R):5'- GGAAGTTCGGTGGCTATAGC -3'

Sequencing Primer
(F):5'- CAAATGGCAGGCGTCTCAGAC -3'
(R):5'- GCAACCTGCGAGTTCCC -3'
Posted On2017-10-10